ID: 1015939200

View in Genome Browser
Species Human (GRCh38)
Location 6:138431748-138431770
Sequence GGCACAGGGGTGAGTGCTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 371}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015939190_1015939200 17 Left 1015939190 6:138431708-138431730 CCCCTTCCCGTTTGCTGGTGACA 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1015939200 6:138431748-138431770 GGCACAGGGGTGAGTGCTGTGGG 0: 1
1: 0
2: 1
3: 38
4: 371
1015939193_1015939200 11 Left 1015939193 6:138431714-138431736 CCCGTTTGCTGGTGACACTGATT 0: 1
1: 1
2: 0
3: 20
4: 152
Right 1015939200 6:138431748-138431770 GGCACAGGGGTGAGTGCTGTGGG 0: 1
1: 0
2: 1
3: 38
4: 371
1015939191_1015939200 16 Left 1015939191 6:138431709-138431731 CCCTTCCCGTTTGCTGGTGACAC 0: 1
1: 0
2: 0
3: 3
4: 107
Right 1015939200 6:138431748-138431770 GGCACAGGGGTGAGTGCTGTGGG 0: 1
1: 0
2: 1
3: 38
4: 371
1015939194_1015939200 10 Left 1015939194 6:138431715-138431737 CCGTTTGCTGGTGACACTGATTT 0: 1
1: 1
2: 3
3: 18
4: 214
Right 1015939200 6:138431748-138431770 GGCACAGGGGTGAGTGCTGTGGG 0: 1
1: 0
2: 1
3: 38
4: 371
1015939192_1015939200 15 Left 1015939192 6:138431710-138431732 CCTTCCCGTTTGCTGGTGACACT 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1015939200 6:138431748-138431770 GGCACAGGGGTGAGTGCTGTGGG 0: 1
1: 0
2: 1
3: 38
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015939200 Original CRISPR GGCACAGGGGTGAGTGCTGT GGG Exonic
900181706 1:1313952-1313974 GCCACAGGGGAGAATGCTGCAGG + Intronic
900286982 1:1906526-1906548 GGCACAGGGTCGAGGGCAGTGGG + Intergenic
900418097 1:2544164-2544186 GGCCCAGTGGGGAGGGCTGTGGG + Intergenic
901137828 1:7009228-7009250 GGCAGAGTTGTGAGTGCTGGAGG + Intronic
901138456 1:7012574-7012596 TCCACAGGGCTGAGTGCTGTGGG + Intronic
901208042 1:7508570-7508592 GGCACAGTGCTGGGTGCTGGGGG - Intronic
901955158 1:12778739-12778761 GACACAGGGGCTGGTGCTGTTGG + Intergenic
901964718 1:12857071-12857093 GCTTCAGGTGTGAGTGCTGTGGG - Exonic
902482165 1:16717751-16717773 GGCGCGTGGGTGAGTGCTGAGGG - Intergenic
902667729 1:17951417-17951439 GGCACAGTGGCCAGTGCTGAAGG - Intergenic
903391365 1:22965613-22965635 AGCAAAGGGGTGGGTGCTCTTGG - Intergenic
903833774 1:26189940-26189962 GGGACTGGGGTGAGTGCTCTTGG + Intergenic
903968935 1:27106658-27106680 GGCACTGGGGTGAGGCATGTGGG + Intronic
904256753 1:29259363-29259385 GGCGCAGGGGTAAGGGGTGTGGG + Intronic
904974747 1:34447390-34447412 GGCACAGGGGTGACAGAAGTGGG + Intergenic
905182633 1:36176394-36176416 TGCAGAGGGATGAGTGCGGTCGG - Exonic
905875106 1:41427385-41427407 GGCACAAGGGTGGGAGCTGGGGG - Intergenic
906211751 1:44016117-44016139 GGCCCTGGGGTGAGTGATGGAGG + Intronic
906260063 1:44380302-44380324 CTAACAGGGGTGTGTGCTGTGGG + Intergenic
906380992 1:45332093-45332115 GGCACAGGGTTGAGTGTCATAGG + Intronic
908939148 1:69410613-69410635 GGCAACAGGGTGAGGGCTGTGGG + Intergenic
910111976 1:83692783-83692805 GGCACAGCTGTGAGAGCTGCAGG - Intergenic
911205658 1:95089694-95089716 GGAGCTGGGGTGAGTGCTTTTGG + Intergenic
913167354 1:116200403-116200425 GGCCCAGGGGCGAGGGCAGTTGG + Intergenic
913480965 1:119288858-119288880 GGCACAGGGCTGACTGCTGGGGG + Intergenic
915562012 1:156693040-156693062 GGGACAGGGCTGTGGGCTGTGGG - Intergenic
915608564 1:156971683-156971705 GGCTCAGTGGTGAGTGATGTAGG - Exonic
915737247 1:158092924-158092946 GGCACAGTGGTGAAAGATGTCGG + Intronic
915812724 1:158931869-158931891 GGCAGTGGGGTGAGGGCAGTAGG + Intronic
916079589 1:161224102-161224124 GGGACAGGGTTGAGGGCTATGGG + Intergenic
919048213 1:192480596-192480618 GGAGCCGGGGTGAGTGCTTTGGG - Intergenic
919296181 1:195703264-195703286 GGCTTAGGGGTTAGTGTTGTGGG - Intergenic
920093075 1:203467977-203467999 GTCAAAGAGGAGAGTGCTGTCGG + Intergenic
920417441 1:205808303-205808325 GCCACAGGGGTTAGTGGTGTGGG + Intronic
920673362 1:208021754-208021776 GGCACTGTGGTAAGTGCTGGGGG - Intergenic
921360743 1:214329284-214329306 CGCACAGGGCTGGGTGCTGCAGG - Intronic
922901577 1:229141205-229141227 GGCAGAGCTGTGAGAGCTGTAGG + Intergenic
923023655 1:230187433-230187455 GGGGCTGGGGTGAGTGCTTTTGG + Intronic
923515287 1:234692656-234692678 GGCTCTGGGGAGAGTGCTGTGGG - Intergenic
923764681 1:236882195-236882217 GGTCCATGGCTGAGTGCTGTGGG + Intronic
1064362254 10:14676893-14676915 GCCACCCGGGTGATTGCTGTAGG + Intronic
1064639704 10:17403150-17403172 GGCTCAGGCGTGAGTCCTTTGGG + Intronic
1065486000 10:26237105-26237127 GGCACGGGGGAGAGAGCAGTGGG + Intronic
1067048979 10:43001212-43001234 GGCAGAGGGGTGGGTGCTGAAGG + Intergenic
1067472081 10:46544785-46544807 GAAAAAGGGGTGTGTGCTGTTGG + Intergenic
1067527514 10:47047402-47047424 GGCACAAGGGGCAGTTCTGTGGG + Intergenic
1067537309 10:47122843-47122865 GGAAAGGGGGTGAGTTCTGTGGG - Intergenic
1069306144 10:66972427-66972449 GGCACAGTGGTGCGTGCCTTAGG - Intronic
1069669797 10:70192580-70192602 GGCTCAGTGGTGAGTGATTTGGG + Intergenic
1070097556 10:73352565-73352587 GACACAGTGGTGAGTTCTTTGGG - Intronic
1071490170 10:86130895-86130917 GGAACTGGGGTGAGCGCTTTTGG - Intronic
1072054482 10:91740720-91740742 GGCACAGGGGAGGCTGCGGTTGG + Intergenic
1072114085 10:92352136-92352158 GGCACTGTGCAGAGTGCTGTAGG + Exonic
1074382511 10:112992173-112992195 GGCAGAGGCGTGAGTGGTCTAGG + Intronic
1074386128 10:113018038-113018060 GGCACAGTGCTGGGTGCTGGGGG + Intronic
1076024572 10:127100988-127101010 GGCAGAGGGGTGAGAACTGAAGG + Intronic
1077743333 11:4872494-4872516 GGCTCAGGGGTGAGTGGGGGAGG - Intronic
1078445750 11:11403792-11403814 GGTACAGGAGAGAGTGCTGACGG + Intronic
1079351794 11:19698050-19698072 AGCACAGGGCTGAGTGCTGATGG + Intronic
1081864089 11:46350256-46350278 GGCCAAGGGGTGGGTGCTGGGGG + Intronic
1083627007 11:64077080-64077102 GGCACTGGGCTGAGGCCTGTGGG - Intronic
1084085599 11:66853688-66853710 GGGGCAAGGGTGACTGCTGTGGG - Intronic
1084462908 11:69306275-69306297 GGCACAGAGTTGGGTGCTGCGGG + Intronic
1084717385 11:70882655-70882677 AGCACAGGGGTGAGGGGTGGCGG + Intronic
1084857824 11:72000206-72000228 GGCTAAGGGGTGGGTGCTGAGGG + Intronic
1085528871 11:77179976-77179998 CGCCCAGGGGTCAGAGCTGTGGG - Intronic
1087908575 11:103727023-103727045 GGCACATGGGTGCAAGCTGTTGG + Intergenic
1088116876 11:106322307-106322329 GGATCAGGGGTGAGAGATGTCGG + Intergenic
1088657747 11:112016564-112016586 GGCAAGGGTGTGAGAGCTGTGGG + Intronic
1089020673 11:115211272-115211294 GGCTCAGGGGTCAGTGCACTTGG - Intronic
1089581628 11:119485062-119485084 GGGACAGGGGTAAGGGGTGTGGG + Intergenic
1089588001 11:119522189-119522211 GGCAAAGGGATGAGTGGTCTAGG + Intergenic
1089781423 11:120875677-120875699 GGCATGGGGGTGGGAGCTGTGGG - Intronic
1089794500 11:120969416-120969438 GGGGCAGGAGTCAGTGCTGTGGG + Intronic
1090244001 11:125202723-125202745 GGGGGAGGGGTGAGTGCTCTGGG + Intronic
1091278815 11:134370453-134370475 GGCAGGGAGGTGAGTGCTGGGGG + Intronic
1095781541 12:46065586-46065608 TCCACAGTGGTGAGTGCTCTGGG + Intergenic
1096427908 12:51519968-51519990 AGCACAGTGGTGAGGCCTGTGGG + Intergenic
1096623036 12:52876446-52876468 GGGGCAGTGGTGCGTGCTGTGGG - Intergenic
1098902878 12:76131334-76131356 GGCACAGGGGTGGGGGTTGTGGG - Intergenic
1099076268 12:78113214-78113236 GGCACATGGGTGCAAGCTGTAGG + Intronic
1099635543 12:85206620-85206642 GGCACAGAGGAGAGTGAGGTTGG + Intronic
1100306357 12:93353289-93353311 GGCACAGCTGTGAGTGCGGGGGG + Intergenic
1102053415 12:109879586-109879608 AGGACAGGGGTGAGGGTTGTCGG - Intronic
1102779690 12:115553395-115553417 GGTGCAGGGGTGAGGGCTTTGGG - Intergenic
1103187479 12:118972196-118972218 TGCACACGTGTGCGTGCTGTGGG + Intergenic
1103322272 12:120099189-120099211 GGCAAGGGGGTGACTCCTGTCGG - Intronic
1103523181 12:121549738-121549760 GGAAGAGGGGTGAGGACTGTGGG - Intronic
1103933004 12:124460473-124460495 AGCACAGGGTTGAGGGCAGTGGG + Intronic
1103995620 12:124828248-124828270 GGTGCAGGGGAGAGTGCTGTGGG - Intronic
1104841852 12:131829371-131829393 GGAACAGGGGAGGGGGCTGTAGG - Intronic
1104970253 12:132527728-132527750 GGGGCAGGGTTGAGGGCTGTGGG + Intronic
1106412915 13:29523605-29523627 CCCACAGGGCTGAGTGCTGGAGG - Intronic
1107614665 13:42152893-42152915 GGGGCAGGTGTGAGTGCTTTTGG + Intronic
1107992604 13:45831659-45831681 CAGACAGCGGTGAGTGCTGTGGG + Intronic
1111132599 13:83996598-83996620 GGCACAGAGGTGAGGGCGGCAGG - Intergenic
1112128766 13:96498425-96498447 GGCCCAGAGGTGAGTGCTGCTGG - Intronic
1113649925 13:112027859-112027881 GGCACAGGGGTGTCTCCTGAAGG + Intergenic
1114261829 14:21042579-21042601 GGGAAAGGGGAGAGTGATGTTGG + Intronic
1114574426 14:23699545-23699567 GGAGCCGGGGTGAGTGCTTTTGG + Intergenic
1115747189 14:36449731-36449753 GGCACAGGTGGGAGTGGTGCTGG + Intergenic
1115971099 14:38945546-38945568 GGCACTGGGATTAGTGGTGTGGG + Intergenic
1117191525 14:53297107-53297129 GGCACAGGTCTAGGTGCTGTGGG + Intergenic
1118307000 14:64663102-64663124 GGCACCAGGCTGGGTGCTGTGGG - Intergenic
1119378574 14:74214417-74214439 GGCCCATGGCTGAGCGCTGTGGG - Intergenic
1121233100 14:92372694-92372716 GGCCCAGGGGAGAGAGCTGAGGG - Intronic
1121246006 14:92461188-92461210 GGCGCAGGAGAGAGTCCTGTTGG - Intronic
1121323971 14:93009079-93009101 GGCAGGGTGGGGAGTGCTGTTGG + Intronic
1121812901 14:96907308-96907330 GGCACTGGGGTGGCTACTGTAGG - Intronic
1122546905 14:102528052-102528074 GGCCCAGGGGTGATGGCTGTTGG + Intergenic
1122593329 14:102871154-102871176 AGCCCAGGCTTGAGTGCTGTGGG - Intronic
1122641755 14:103164152-103164174 GGAGCCGGGGTGAGTGCTTTTGG - Intergenic
1122882612 14:104696866-104696888 GGCACAGGGCTGGGTGCTTCTGG - Intronic
1122921142 14:104880732-104880754 TGCACAGGGGTGAGTGGTGTGGG - Intronic
1122921177 14:104880921-104880943 TGCACAGGGGTGAGCAGTGTGGG - Intronic
1202904410 14_GL000194v1_random:60050-60072 GGCCCAGGGGCCTGTGCTGTAGG - Intergenic
1123918058 15:25051812-25051834 AGCACAGGGGTGTGTGCTACTGG + Intergenic
1124089159 15:26581554-26581576 GGCCCAGGGGTCAGGCCTGTAGG - Intronic
1124249822 15:28099380-28099402 GGCCGAGTGGGGAGTGCTGTGGG - Intergenic
1124415054 15:29467020-29467042 GGCCCAGGGGTGGATGCTGATGG + Intronic
1124991408 15:34677584-34677606 GGCACAGTGGTGGGTGCTGAAGG + Intergenic
1125318126 15:38454224-38454246 GGCGCTGGGGTGAGTGCTTTTGG + Exonic
1126075376 15:44904043-44904065 GGCACTGTGCTGGGTGCTGTGGG + Intergenic
1126082994 15:44983744-44983766 GGCACTGTGCTGGGTGCTGTGGG - Intergenic
1126098781 15:45107331-45107353 GGCATAAAGGTGAGTGCCGTGGG - Exonic
1128312528 15:66640257-66640279 GCCACTGTGGGGAGTGCTGTTGG + Intronic
1128715167 15:69902697-69902719 GGCATAGGGGATAGTACTGTAGG - Intergenic
1129566150 15:76625381-76625403 CCCACAGGGGTGGCTGCTGTTGG + Intronic
1129702166 15:77774316-77774338 GGCAGAGGGCTGAGGGCTGTTGG - Intronic
1130139123 15:81208780-81208802 GGCACAGGGGTTAGGTGTGTGGG + Intronic
1130141348 15:81228780-81228802 GGCACAGGGGTTAGGTGTGTGGG + Intronic
1131787772 15:95931604-95931626 GGTCCAGGGGAGAATGCTGTGGG + Intergenic
1132225433 15:100137290-100137312 TGCACTGGGGTGGGAGCTGTGGG + Intronic
1132503005 16:292925-292947 GGCACAGTGAGGAGGGCTGTGGG + Intronic
1132651367 16:1022751-1022773 GGCAGAGGGCTGGGTGCGGTGGG + Intergenic
1132666241 16:1082520-1082542 GGCACAGGGGGGTTAGCTGTGGG + Intergenic
1132863649 16:2083417-2083439 GGCACAGGGGTGGCTGCTGGTGG + Intronic
1134056417 16:11173025-11173047 GGCACAGGGGTGGGTCCAGATGG - Intronic
1134602292 16:15542858-15542880 GGGGCTGGGGTGAGTGCTTTTGG + Intronic
1135270741 16:21067554-21067576 TGCACAGGGGTGAATGCTTATGG + Intronic
1135862266 16:26067506-26067528 GGCACAGGGGTGGCTGGGGTGGG - Intronic
1135926895 16:26702475-26702497 TGCAAAGGGGTGAGTGTGGTGGG + Intergenic
1136069527 16:27779436-27779458 GGCACTGGGGTGAGTTCTTCTGG - Exonic
1136180527 16:28548765-28548787 GGCCCAGGGGTGGGTGGGGTGGG - Intergenic
1136497815 16:30654780-30654802 GGGACGGGGGTGGGGGCTGTGGG - Exonic
1137581195 16:49634571-49634593 GACACAGGGGTGTTTGCTGAGGG - Intronic
1138485919 16:57343524-57343546 GGCACTGAGGTGAGTGATCTTGG + Intergenic
1138627590 16:58264904-58264926 GGCACTGGGCTGAGTGCTAAGGG + Intronic
1139001851 16:62520218-62520240 GATGCAGAGGTGAGTGCTGTGGG + Intergenic
1139354483 16:66359481-66359503 GGCACAGTGGTAAGAGCAGTGGG - Intergenic
1139401486 16:66685382-66685404 GGCTCAGGGAAGACTGCTGTGGG + Intronic
1139492391 16:67293327-67293349 GGCGAAGGGATGAGTGCTGTGGG - Intronic
1139671037 16:68492679-68492701 GGCACAGGGTGGGGAGCTGTGGG + Intergenic
1140266519 16:73426036-73426058 GGCCCAAGGGTGAGTGCTATGGG - Intergenic
1140455760 16:75104753-75104775 GGGACAGGGGAGAGTGCAGGAGG - Intronic
1141209122 16:81959710-81959732 GGCACTGGGATGAGTGCTGCAGG + Exonic
1141807316 16:86350383-86350405 GGCAGAGGGGAGAGTGCTCAGGG - Intergenic
1141877252 16:86834400-86834422 GGGACGGGTGTGGGTGCTGTGGG + Intergenic
1142034734 16:87855983-87856005 GGCACAGCAGTGAGTCCTGCAGG + Intronic
1142133063 16:88439623-88439645 GGCGCAGGGGTGTGGGCTGAGGG - Exonic
1142267842 16:89072682-89072704 GGCCCAGGGGTGGGTGCTGGTGG + Intergenic
1142958053 17:3534770-3534792 GGCACAGAGGTCAGAGCTGGAGG + Intronic
1143556953 17:7667982-7668004 GGAACAGGGGTGGGTGCTACTGG - Intronic
1145078757 17:19876969-19876991 GGCACAGCGCTGTGGGCTGTGGG - Intergenic
1145999990 17:29125308-29125330 GGCAGAGGTGGGAGTGCTATAGG - Intronic
1147337405 17:39735866-39735888 GTCAGAGGGCGGAGTGCTGTAGG - Intergenic
1147572053 17:41577352-41577374 GGCATTGGGCTGAGTGCTGGGGG + Intergenic
1150732904 17:67711312-67711334 GGCACAGAGGTGAGGGGGGTGGG + Intergenic
1151477145 17:74350596-74350618 GGCACAGGGGTGGGGCCTGGAGG - Intronic
1151576043 17:74953101-74953123 GGAACAGGGGTGAGGGATGGTGG + Intronic
1151866261 17:76805352-76805374 GGCCCAGGGTGGAGTGCAGTGGG + Intergenic
1152565714 17:81099477-81099499 GGCACAGGTGAGAGTGCTCCAGG + Intronic
1152808762 17:82371496-82371518 GGCGCAGGGGTGAACGCTGGAGG + Intergenic
1152943666 17:83186355-83186377 GGCAGAGGCTAGAGTGCTGTGGG + Intergenic
1153309283 18:3662375-3662397 GGCTCAGAGTTGGGTGCTGTGGG - Intronic
1153589855 18:6661909-6661931 GGCACAGGTGTGAATGATGTAGG + Intergenic
1153769039 18:8400781-8400803 GGCACAAGGGGGAGAGCTGTAGG - Intronic
1154431242 18:14310134-14310156 GGCACAGGGGTGTGAGGTCTGGG - Intergenic
1156171848 18:34494386-34494408 GGCACGGGGGTGAGTGTCTTCGG + Intronic
1157312146 18:46560480-46560502 GGCACACGGGCGAGGGCTTTGGG - Intronic
1158174765 18:54642532-54642554 GGCACAGGGCTGGGCTCTGTGGG - Intergenic
1158935198 18:62358106-62358128 GGCACAGGGGTGGGAGGTGAGGG + Intronic
1159997342 18:74978932-74978954 GGGAGAGGCGTGAGGGCTGTGGG + Intronic
1161101518 19:2424216-2424238 GGCAGAGAGGTGGCTGCTGTCGG + Exonic
1162114520 19:8420688-8420710 GGCATAGGCAGGAGTGCTGTGGG + Intronic
1162765298 19:12915731-12915753 GGTACAGGGGTGAGTGCAAGGGG - Intronic
1163258124 19:16170157-16170179 GGCCCAGGGCTGAGTGTTCTTGG - Intronic
1163497358 19:17654731-17654753 GGCAAAGGGGTCAGTGCTTAGGG - Intronic
1163517731 19:17775072-17775094 GATTCAGGGGTGAGTGATGTGGG + Exonic
1163623133 19:18372658-18372680 GGAGGAGAGGTGAGTGCTGTGGG + Intergenic
1164401618 19:27905838-27905860 TGTACAGGGGTGTGTGGTGTGGG - Intergenic
1165026563 19:32966755-32966777 ATCACTGGGGGGAGTGCTGTGGG - Intronic
1165068061 19:33240501-33240523 TGCACACAGGTGAGTGCTGTGGG + Intergenic
1165905336 19:39190761-39190783 GGCACAAGAGTAAATGCTGTGGG - Intergenic
1166097696 19:40551346-40551368 TGCACAGGGTGGAGTGCAGTGGG - Intronic
1166342511 19:42147208-42147230 GGCAAAGAGGTGAGTGATGGGGG - Intronic
1167212630 19:48142969-48142991 TACACAGGGGCGAGTGCTGGGGG + Intronic
1167825540 19:51969687-51969709 GGCACAGTGGTGAGTGCCTGTGG + Intronic
1168644769 19:58052917-58052939 GGAACAAGGGCCAGTGCTGTGGG + Intronic
925046832 2:778613-778635 GGCATGGGGGTGAGTGCAGGTGG - Intergenic
925942443 2:8834094-8834116 TGCACAGGGGTGATTGTTGCTGG - Intronic
926374952 2:12217950-12217972 TGCAAAGGGTTGAGTGCAGTGGG + Intergenic
927496440 2:23554701-23554723 GGCCCAGGGCTGAGGGCTGCTGG + Intronic
927573661 2:24182447-24182469 AGCACTGGGATGAGTGCTGTGGG + Intronic
928168900 2:28990796-28990818 GGCTCATGGGTGAGAGCTGGAGG + Intronic
928226222 2:29450409-29450431 GGCACAGGGCTGAGCCCTGTAGG + Intronic
930013868 2:46957612-46957634 GGGACATGGGTCAGTGATGTAGG + Intronic
931643335 2:64400322-64400344 TGCATAGGGGTGAGTCATGTAGG + Intergenic
932345561 2:70993165-70993187 GCCATAGGGGTGACTGCTGGTGG - Intronic
934502236 2:94870350-94870372 GGCCCAGAGGTCTGTGCTGTAGG + Intergenic
935699196 2:105796305-105796327 GGCACACAGGAGAGTGCTGGAGG + Intronic
936404780 2:112193152-112193174 GGCATAGGGCTGGGTGCGGTGGG + Intergenic
937153675 2:119703169-119703191 GGCCCAGGGCTGAGGGCTGAGGG - Intergenic
938055340 2:128209976-128209998 GGCACAGGGGAGAGTACTCATGG + Intergenic
938114667 2:128595019-128595041 GGCCCAGGGGTGAGTGGGGAAGG - Intergenic
938291232 2:130151859-130151881 GGCACAGGGGTCCGCGATGTTGG + Exonic
938338944 2:130522908-130522930 GGCACAGGGGTGCGCGGGGTGGG + Intronic
938350894 2:130597842-130597864 GGCACAGGGGTGCGCGGGGTGGG - Intronic
938465309 2:131521100-131521122 GGCACAGGGGTCCGCGATGTTGG - Intergenic
938899964 2:135791452-135791474 GCCACAGGGGTGCCTGCTGGGGG + Intronic
939739234 2:145885628-145885650 GGCACAGGGGAGCTTGATGTGGG + Intergenic
942123498 2:172801566-172801588 GGCAGTGTGGTGAGTGCTGGTGG - Intronic
943348645 2:186771761-186771783 AGCACAGGGAAGAGTCCTGTGGG + Intergenic
943559224 2:189441389-189441411 GGCCCGGGGGTGGGTTCTGTGGG + Intergenic
943683412 2:190791765-190791787 GGGGCTGGGGTGAGTGCTGTGGG - Intergenic
943890162 2:193276770-193276792 GTCAAAGGGCTCAGTGCTGTCGG - Intergenic
944231659 2:197400388-197400410 GGCACAGTGGTTAATGCTCTTGG - Exonic
944254773 2:197614634-197614656 GGAGCTGGGGTGAGTGCTGTGGG - Intronic
946033188 2:216721356-216721378 GGCCCATGGGTGATGGCTGTTGG - Intergenic
946250183 2:218406712-218406734 GGGAAAGGGGTGAGTGAGGTGGG - Intergenic
947702262 2:232244290-232244312 GGGACAGGGGTGAGGAGTGTGGG + Intronic
949022377 2:241748855-241748877 GGCACACAGGTGACTGCAGTTGG - Intronic
949028597 2:241777716-241777738 GTCACAGGGCTGAGAGGTGTGGG + Intronic
1170652777 20:18257720-18257742 GTCATGGGGGTGAGGGCTGTAGG + Intergenic
1171464032 20:25315487-25315509 GGCACAGGGGTGGGTGTTTGAGG - Intronic
1172173756 20:32960221-32960243 GGCACAAGGGTGGCTGCTGGTGG - Intronic
1173563689 20:44023911-44023933 GGGAAGGGGGTGAGTGCTGGTGG - Intronic
1174182534 20:48683862-48683884 GGTACAGGGGAGAGTGTTCTGGG + Intronic
1174394758 20:50240138-50240160 GGCACTGTGCCGAGTGCTGTAGG - Intergenic
1174545054 20:51318846-51318868 AGGACAGGGGTGGGTGCTGGGGG + Intergenic
1174971481 20:55280929-55280951 GACACAGAGGTGAGTTCTCTGGG + Intergenic
1175534002 20:59694814-59694836 GGGACAGGGGGAAATGCTGTGGG + Intronic
1175659932 20:60803807-60803829 GGCACAGCAGTGAGGGCTCTTGG + Intergenic
1175823656 20:61925007-61925029 GCCACAGGGGTCTGTGCCGTGGG - Intronic
1176232037 20:64037661-64037683 GTGAAAGGGGTGAGTGATGTCGG - Intronic
1176382775 21:6121379-6121401 GGCACAGCGGGGAGGGCGGTGGG - Exonic
1177967280 21:27744091-27744113 TGCAAAGGGTTGAGTGCAGTGGG - Intergenic
1178766483 21:35457581-35457603 AGCACTGGGGTAAGTGCTGATGG + Intronic
1179740694 21:43416860-43416882 GGCACAGCGGGGAGGGCGGTGGG + Exonic
1180732092 22:17989694-17989716 GGCACATGGGTGAGAGGAGTTGG - Intronic
1181527817 22:23500230-23500252 GGCACAGGGGAGAATGCCATGGG + Intergenic
1181627898 22:24133789-24133811 GGCCCAGGGGAGAATGGTGTAGG - Intronic
1181991777 22:26842408-26842430 CGCTCAGGGCTGAGGGCTGTGGG + Intergenic
1182316141 22:29448662-29448684 GGCACAGGGCTGTGTTCTGAGGG - Intergenic
1182353204 22:29710443-29710465 GGCACAGGGAAGAGGGCTGGGGG - Intergenic
1182645722 22:31807802-31807824 GGCAGAGGGGTGAGAGCACTCGG - Intronic
1182772850 22:32808356-32808378 GGCACTTGGGTGAGAGCAGTGGG + Intronic
1183165899 22:36147303-36147325 GCCACAGGGATCAGTGCTGAGGG - Intronic
1183214636 22:36471463-36471485 GGCACAGTGCTGGGTGCTGCGGG + Intronic
1183442915 22:37833432-37833454 GCCACAGTGCTGAGTGCTGCTGG + Intronic
1183583382 22:38738608-38738630 GGCACTGGAGATAGTGCTGTTGG + Exonic
1184033788 22:41909317-41909339 GGCACAGGAGAGAGGGCTGTTGG - Intergenic
1184175168 22:42784948-42784970 GACACAGGGGTGAGGGATGCAGG - Intergenic
1184255935 22:43287027-43287049 GGCACAAGGGTGTGTGATGGGGG + Intronic
1184425948 22:44409426-44409448 AGCACAGGTGTGAGGGCTGCTGG - Intergenic
1184434093 22:44459531-44459553 GGGACAGAGGTGAGTGGAGTTGG - Intergenic
1184552742 22:45213259-45213281 GGCAGAGGGCTGAGGGCTGAGGG - Intronic
1184847930 22:47100433-47100455 GGCACAGGGGTGAGGCCTCGGGG + Intronic
1185215817 22:49599463-49599485 GGTACAGGGGTGAGGTCTGGAGG - Intronic
1185224283 22:49644112-49644134 GGCAGAGGGGTCAATGCTGGGGG - Intronic
950269303 3:11600959-11600981 GGTACAGTGGTGAGGGCGGTTGG - Intronic
950978968 3:17280966-17280988 GGAGCCGGGGTGAGTGCTTTTGG - Intronic
951089853 3:18559992-18560014 GGGAGAGGGGTGTGTGATGTGGG - Intergenic
951251190 3:20395822-20395844 GGAGCTGGGGTGAGTGCTTTTGG - Intergenic
951511861 3:23511226-23511248 GGGACAGGGGAGATTGCTATTGG - Intronic
952419688 3:33119787-33119809 GCCACAGGGGTGATAGCAGTGGG + Intronic
953381051 3:42473245-42473267 GGCACAGGGTGGTGTGCTGCAGG - Intergenic
953704005 3:45217711-45217733 GGCACAGGGGAGAATGGAGTGGG - Intergenic
953750428 3:45604494-45604516 AGCACTGGGTTGAGTGCTGTGGG + Intronic
954372254 3:50175061-50175083 GGAACAGGGGTTAGAGCTGGGGG - Intronic
954436851 3:50500793-50500815 GGCAGAGGGGTTACTGCTGAAGG - Intronic
954625418 3:52019646-52019668 GGCAGAGGGGTGGGGGCTGGAGG + Intergenic
954710014 3:52501004-52501026 GGCACAGAGCTGAGTTCTTTGGG - Intronic
954710264 3:52501974-52501996 GGCACAGAGCTGAGTACTGTGGG + Intronic
954750644 3:52811542-52811564 GGCCCTGGGCTGAGTACTGTGGG - Intergenic
956769198 3:72510162-72510184 GGCACAGGGCTGAGTGCCGGAGG - Intergenic
959099561 3:101994889-101994911 GGCACAGTGGTAAGTACTATAGG + Intergenic
959500143 3:107097712-107097734 GGCAGAGGGATGAGTGCTACTGG + Intergenic
960128824 3:114030884-114030906 GGCCCTGGGGTGGGTGTTGTAGG + Intronic
961180865 3:124876486-124876508 GGCAGAGGGGTGGGTGCAGGAGG + Intronic
962381388 3:134900820-134900842 GGCACATGGGTGTGTGTTGGAGG + Intronic
962948417 3:140195356-140195378 GACACAGTGGTGAGTTCTTTAGG - Intronic
966347750 3:178997834-178997856 GGAACTGGGGTGAGTCCTTTTGG - Intergenic
966890193 3:184401690-184401712 GGTACAGCGGTGAGGGCTGTAGG + Intronic
968685788 4:1957682-1957704 GGCCCAGGGCAGAGTTCTGTCGG - Intronic
968878849 4:3288387-3288409 GGCCCAGAGGGGAGTGCTGGTGG - Intergenic
969260111 4:6028081-6028103 GGCAGAGGGGTGAATTCCGTGGG + Intronic
970838375 4:20438074-20438096 AGAAACGGGGTGAGTGCTGTAGG - Intronic
973200200 4:47491959-47491981 GGCACGGTGCTGAGTGCTTTGGG - Intronic
979596675 4:122542146-122542168 GGAGCTGGGGTGAGTGCTTTTGG - Intergenic
980729194 4:136805016-136805038 GACACAGGAGTGAGTTCTGCAGG - Intergenic
980843661 4:138297939-138297961 AGCAAAGGGGTTAGTGCAGTGGG - Intergenic
981929720 4:150176317-150176339 GGCACAGTGCTGAGTGCTCTGGG + Intronic
984884282 4:184436347-184436369 GGAACTGTGCTGAGTGCTGTGGG + Intronic
985490295 5:175041-175063 GACACGTGTGTGAGTGCTGTCGG - Intronic
986366294 5:7035569-7035591 GGCAGTGGGCTGAGTACTGTGGG + Intergenic
987117680 5:14738857-14738879 TTCACAAGGGTGAATGCTGTCGG + Intronic
987182817 5:15385223-15385245 GAGACTGGGGTGAGTGCTTTGGG + Intergenic
989167452 5:38445773-38445795 GGACCCGGGGTGAGTGGTGTGGG + Intronic
990128457 5:52548681-52548703 GGAGCTGGGGTGAGTGCTTTTGG - Intergenic
990504647 5:56432366-56432388 GGCACAGTGGTGAGCCCTATAGG + Intergenic
990658621 5:57986938-57986960 GGCACACTGGTGGGTGTTGTTGG - Intergenic
992609174 5:78492588-78492610 GGCTCAGGTGTGACTGCTGAGGG + Intronic
997435114 5:133868218-133868240 GGCACAGTGCTGGGTGCTGAGGG + Intergenic
997660980 5:135589426-135589448 GGCACTGGGCTCAGTCCTGTAGG + Intergenic
997972885 5:138418468-138418490 GGCACAGGGATTAATGCTGAGGG + Intronic
998957470 5:147453065-147453087 GGCGCAGGGGTCAGAGCCGTGGG + Intronic
999316005 5:150584662-150584684 GGGAGAGGAGTGTGTGCTGTGGG - Intergenic
999321015 5:150615121-150615143 TGCACAGAGGTGGGTGCTGTGGG + Intronic
999522894 5:152370639-152370661 GGCAGAGGGTAGAGTTCTGTTGG + Intergenic
999967007 5:156820563-156820585 AGCACAGTGGGGAGTCCTGTTGG + Intergenic
1000098725 5:157994247-157994269 GGCACATTGTTGAGGGCTGTGGG - Intergenic
1001266035 5:170275284-170275306 GGCTCAGAGGTGATTGCTTTAGG - Intronic
1001566242 5:172701250-172701272 GGGGCAGGGGTGAGGTCTGTCGG - Intergenic
1002523228 5:179802690-179802712 GGCCCAGGCATGAGGGCTGTAGG + Exonic
1002629581 5:180562142-180562164 GGCACAGGGATGAGTTCCCTGGG - Intronic
1002763962 6:223854-223876 GTCACTGCGCTGAGTGCTGTCGG + Intergenic
1003390024 6:5705758-5705780 GGCACAGGGGCGCGAGCTGAGGG - Intronic
1005894590 6:30167077-30167099 GGCACACTGTTGAGTGCTGAGGG - Intronic
1006084735 6:31587759-31587781 GGCACAGGGGGCACTGCTGCAGG - Intronic
1006803050 6:36771612-36771634 GGCACTGTGTTGGGTGCTGTGGG - Intronic
1006830815 6:36967211-36967233 AGAACAGTGGTCAGTGCTGTGGG + Intergenic
1007432457 6:41784684-41784706 GTGACAGGGCTAAGTGCTGTGGG + Intronic
1008647269 6:53527496-53527518 GACAAAGGGGTTAGTGCTGGGGG - Intronic
1010233731 6:73557839-73557861 GGCCCAGGCTTGAGTGCAGTGGG + Intergenic
1010634436 6:78240140-78240162 GGAGCTGGGGTGAGTGCTTTTGG - Intergenic
1011883621 6:92063115-92063137 GGCCCAGGTGAGAGTGCAGTGGG + Intergenic
1013402476 6:109812315-109812337 GGCACAGAGGCATGTGCTGTGGG + Intronic
1014207648 6:118673566-118673588 GGCACAATGGTGAGGTCTGTGGG + Intronic
1015939200 6:138431748-138431770 GGCACAGGGGTGAGTGCTGTGGG + Exonic
1016569042 6:145492291-145492313 GGAGCTGGGGTGAGTGCTTTTGG + Intergenic
1018767349 6:166944840-166944862 GGCAGAGGGGACAGTGCTGGTGG - Intronic
1019359373 7:596802-596824 GGCCCAGTGGTGTGTGCTGGTGG - Intronic
1019426088 7:977546-977568 GGCCCCGGGGTGGGGGCTGTTGG - Intergenic
1019594307 7:1851290-1851312 GGCACAGGGTTGGGGGCTGATGG + Intronic
1019664525 7:2244769-2244791 GGCACAGGGATTCGGGCTGTAGG + Intronic
1019893420 7:3964728-3964750 TCCTCAGGGGTGAGAGCTGTTGG + Intronic
1020955442 7:14734933-14734955 GGCACAGGGGTTGGGGCGGTGGG + Intronic
1021095064 7:16526734-16526756 GGCACAAGGGTGGGTGTTGCAGG + Intronic
1021877510 7:25062419-25062441 GGCTCAGGGATGGGTGCTCTCGG - Intergenic
1021879080 7:25076492-25076514 GGCACAGAGGTGTGTGATATGGG + Intergenic
1023754382 7:43402328-43402350 GGAACCGGAGTGAGTGCTTTTGG - Intronic
1023939246 7:44759491-44759513 GGCTCCGTGCTGAGTGCTGTGGG + Intronic
1024035048 7:45500800-45500822 GGGACAGGGCTGGATGCTGTGGG + Intergenic
1025035161 7:55589230-55589252 GGAAAAGGGGGGAGTGCAGTGGG - Intergenic
1030342497 7:108396036-108396058 GGATAAGGGGTGAGTGCTGTGGG - Intronic
1030386104 7:108870270-108870292 GGAGCCGGGGTGAGTGCTTTTGG + Intergenic
1030691552 7:112540229-112540251 TTGACAGAGGTGAGTGCTGTGGG + Intergenic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1031913467 7:127541301-127541323 GGCACAAAGGTAAGTGCTGTTGG - Intergenic
1032282640 7:130516944-130516966 GGCACAGGGCAGAGGGCAGTGGG + Intronic
1032761792 7:134950305-134950327 GCCAAAGGGAAGAGTGCTGTAGG - Intronic
1032973742 7:137196723-137196745 AACACAGTGGTGAGTTCTGTGGG - Intergenic
1034936272 7:155202852-155202874 GGCCTTCGGGTGAGTGCTGTGGG + Intergenic
1035370401 7:158376136-158376158 GGAGCCGGGGTGAGTGCTTTTGG - Intronic
1036689905 8:10938714-10938736 GGCACATGGGAGAGTGTTCTGGG + Intronic
1037943883 8:22974477-22974499 TGCGCTGGAGTGAGTGCTGTGGG - Intronic
1039064697 8:33598490-33598512 GGGACAGGGGTGGGTGGTGGGGG + Intronic
1040536712 8:48316949-48316971 GGCCAAGGGCTGAGTGCAGTGGG + Intergenic
1042508763 8:69589716-69589738 GGCACAAGGGAGAGGGCTGATGG + Intronic
1043243314 8:77964535-77964557 GCCACATGTGTGAGTGCTCTTGG + Intergenic
1044173811 8:89091268-89091290 GGCTCAGGGGAGAGGGCAGTGGG + Intergenic
1045317928 8:101059387-101059409 GGCATAGGGGTGTGTGCTTGTGG - Intergenic
1046771286 8:118118948-118118970 GACGCAGGTGGGAGTGCTGTTGG - Intergenic
1048266413 8:132991242-132991264 GCCACTGTGGAGAGTGCTGTGGG - Intronic
1049211898 8:141390786-141390808 GGCAGAGTGGAGAGTGCAGTGGG + Intergenic
1049641613 8:143718603-143718625 GGCACAGCGGTGAGGTCTGCAGG - Intronic
1049784135 8:144442540-144442562 GGCACAGGTGTGAGAGGTGGGGG + Intronic
1050976044 9:11939888-11939910 AGCACAGTGGTGAGTTCTCTGGG + Intergenic
1051337116 9:16076088-16076110 GGTAGAGGGGTGAATGCTCTGGG + Intergenic
1052280619 9:26729358-26729380 GGCAGCTGGGTGATTGCTGTAGG - Intergenic
1055376060 9:75649058-75649080 GGAGCTGGGGTGAGTGCTTTGGG + Intergenic
1057266551 9:93621473-93621495 GGCCCAGGGGTGGGTGGTGCTGG + Intronic
1057439847 9:95074945-95074967 GGCAGAGGTGTGGGTGCTGCAGG + Intronic
1057493635 9:95542642-95542664 GGCACAGAGCTGGGTGGTGTGGG + Intergenic
1057893802 9:98890220-98890242 GGCACAGGGGAGAGGGGAGTAGG - Intergenic
1057902166 9:98957963-98957985 GGCACAGGGCTAGGTGCTGGTGG - Intronic
1058120833 9:101136823-101136845 TGGACAGGGGTGAGAGATGTGGG + Intronic
1058949475 9:109890308-109890330 GCCACAGGGAAGAGTACTGTGGG + Intronic
1059328957 9:113523139-113523161 GGCACTGGAGTGTGTGCTGCTGG + Intronic
1060023600 9:120152466-120152488 GGCAGAGGGGACAGTGCTGCAGG + Intergenic
1060520686 9:124292309-124292331 GGGACAGGGGTGGCTGCTGATGG + Intronic
1060958310 9:127660660-127660682 TTCTCAGTGGTGAGTGCTGTGGG - Intronic
1060971683 9:127741995-127742017 GGGACAGGGGTGAGGGGTGCGGG + Intronic
1062284830 9:135768279-135768301 GGCACAGGGATGCCTGCTGGTGG + Intronic
1062368347 9:136222858-136222880 GGGACAGGGGTGAGGGGTCTGGG + Intronic
1062560353 9:137138941-137138963 GGGACAGGGGCCTGTGCTGTCGG - Intronic
1062599838 9:137314785-137314807 GGCTCTGGGGTGAGGGCTGTGGG - Intronic
1203746963 Un_GL000218v1:45245-45267 GGCCCAGGGGCCTGTGCTGTAGG - Intergenic
1203563143 Un_KI270744v1:74235-74257 GGCCCAGGGGCCTGTGCTGTAGG + Intergenic
1188182460 X:27072905-27072927 GGAGCCGGGGTGAGTGCTCTTGG - Intergenic
1189835150 X:45012564-45012586 AGCTCACGGGTGAGTTCTGTGGG + Intronic
1190337300 X:49270163-49270185 GGCACAGCGGTGAGGGCTCGGGG - Exonic
1190775296 X:53547774-53547796 GTGACAGGGGTGGGTGCAGTAGG + Exonic
1191662658 X:63667057-63667079 GGCACAGGGGTGAGTATTCCAGG + Intronic
1195021211 X:100830812-100830834 GTCCCACGGGCGAGTGCTGTAGG - Intronic
1197759999 X:130021202-130021224 GGCACAGTGGTGAGGGCAGAGGG + Intronic
1199337096 X:146630807-146630829 GGAGCTGGGGTGAGTGCTTTTGG - Intergenic
1199833896 X:151569731-151569753 GGCACAGGAGTGAGGGCTGAGGG + Intronic
1201160288 Y:11160259-11160281 GGCCCAGGGGCCTGTGCTGTAGG - Intergenic
1201637958 Y:16146245-16146267 GGAGCTGGGGTGAGTGCTTTTGG - Intergenic