ID: 1015940908

View in Genome Browser
Species Human (GRCh38)
Location 6:138450989-138451011
Sequence CTATTGGAAGAGGAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 368}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015940908_1015940913 -3 Left 1015940908 6:138450989-138451011 CCCTGCTCCTCCTCTTCCAATAG 0: 1
1: 0
2: 1
3: 29
4: 368
Right 1015940913 6:138451009-138451031 TAGTCTACTCTCAATACAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 90
1015940908_1015940914 3 Left 1015940908 6:138450989-138451011 CCCTGCTCCTCCTCTTCCAATAG 0: 1
1: 0
2: 1
3: 29
4: 368
Right 1015940914 6:138451015-138451037 ACTCTCAATACAGCAGGCGAAGG 0: 1
1: 0
2: 0
3: 8
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015940908 Original CRISPR CTATTGGAAGAGGAGGAGCA GGG (reversed) Intronic
900753019 1:4411569-4411591 CAAAAGGAAGAGGAGGAGGAAGG - Intergenic
900761740 1:4477186-4477208 CTATGGTGAGAGGAGGAGCAGGG - Intergenic
902556090 1:17247625-17247647 CTCCTGGAAGAGCAGGAGCAAGG - Intergenic
902602672 1:17550833-17550855 CTGGTGGAGGAGGAGGAGCCAGG + Intronic
902807396 1:18869533-18869555 ATATTAGGAGAGGAGGAGCTTGG + Intronic
904046629 1:27613083-27613105 GTGTTGGAACAGGTGGAGCAGGG - Exonic
904217633 1:28935572-28935594 CTATTTGAAGAAGATGAGTATGG - Intronic
906477357 1:46178621-46178643 CCTGAGGAAGAGGAGGAGCAGGG - Intronic
907389598 1:54149617-54149639 CTAAAGGGAGAGAAGGAGCATGG - Intronic
907501424 1:54884414-54884436 TGAGGGGAAGAGGAGGAGCAGGG + Intronic
907970442 1:59375717-59375739 CACTGGGAATAGGAGGAGCAAGG - Intronic
908812881 1:68001868-68001890 GTATTTAAAGAGGAGGAACAGGG + Intergenic
909982582 1:82120605-82120627 TTATTGAAATAGAAGGAGCAAGG - Intergenic
911524220 1:98964627-98964649 CTCTTGGCAGAGTAGGAGTAGGG - Intronic
911860006 1:102934457-102934479 CTATTGGACCAGGAGGTCCAGGG + Exonic
913134440 1:115874243-115874265 CTATAGGCAGAGCAGCAGCATGG + Intergenic
913689804 1:121268442-121268464 CCATTGAAAGATGATGAGCAGGG + Intronic
914147796 1:145011830-145011852 CCATTGAAAGATGATGAGCAGGG - Intronic
915005202 1:152629198-152629220 CAATGGGGAGAGGTGGAGCAAGG + Intergenic
916261202 1:162844289-162844311 AGTTAGGAAGAGGAGGAGCATGG - Intronic
916458234 1:164993073-164993095 CTGTTGGGAGAAGAGGAGCTAGG - Intergenic
917905470 1:179583784-179583806 CTAGTGGTAGAGCAGGAGTAGGG + Intergenic
919619543 1:199849397-199849419 ACCTTGGAAGAGGAGGAGCTAGG + Intergenic
920477124 1:206286919-206286941 CCATTGAAAGATGATGAGCAGGG + Intronic
921243354 1:213209741-213209763 CTGTAGGCAGAGTAGGAGCATGG + Intronic
923330171 1:232916513-232916535 GAATTGGGAGGGGAGGAGCATGG - Intergenic
923419933 1:233802818-233802840 CCAGTGGGAGAGGAGGAGAAGGG + Intergenic
1064670906 10:17713068-17713090 CAAATGGAGGAGGAGGAGAATGG - Intronic
1064880950 10:20053020-20053042 TTCTTGGAAGAGGAGGAGGATGG + Intronic
1065856642 10:29836496-29836518 CAATGGGAAGAGGAGGAACCTGG - Intergenic
1065887052 10:30087790-30087812 CTATTGGAAAAGGTCTAGCATGG + Intronic
1067163472 10:43846464-43846486 CTAAGGGCAGAGGAGGAGCGGGG + Intergenic
1067348895 10:45457910-45457932 CCAAGGGAAGAGGAGGAGCAGGG - Exonic
1067461541 10:46461967-46461989 GTACTGGAAGAGGAGCAGGAAGG + Exonic
1067625653 10:47922634-47922656 GTACTGGAAGAGGAGCAGGAAGG - Intergenic
1069625752 10:69866804-69866826 CTCTGGGAATGGGAGGAGCACGG + Intronic
1070484160 10:76913701-76913723 ATGTTGGAAGAGGAGTAGAAGGG + Intronic
1071910335 10:90224579-90224601 GTATGGGAAGAGGTGGAGCGGGG + Intergenic
1072319600 10:94235605-94235627 CAATTTGCAGAGGAAGAGCATGG - Intronic
1073015446 10:100395466-100395488 CCTTTGGAAGGGGAGGAGAAAGG - Intergenic
1073467757 10:103704267-103704289 CCACTGGAGGAGGAGCAGCATGG + Intronic
1073482014 10:103791924-103791946 ATATTGGGAGAGGAAGACCAGGG - Intronic
1073634000 10:105178499-105178521 CTAGTGGGAGATAAGGAGCAGGG + Intronic
1074251616 10:111756515-111756537 CTACAGGATGGGGAGGAGCAAGG - Intergenic
1075008158 10:118845251-118845273 CTCTTTGAAGAGGAGGAGGTGGG + Intergenic
1075099182 10:119493973-119493995 CTAGATGAAGATGAGGAGCAGGG + Intergenic
1075600596 10:123765796-123765818 GTACTGGAGGAGGAGCAGCAGGG - Intronic
1075813520 10:125246431-125246453 CTCTTGCAAGGGGAGGAGCGGGG - Intergenic
1075887314 10:125912354-125912376 CTAAAGGAAGAGGAGGAGGGGGG - Intronic
1075987399 10:126799684-126799706 CTATTGTAATAGGAGGAGGGGGG - Intergenic
1077418544 11:2437252-2437274 GTCTTGGAAGAGGAGGAGGTGGG + Intergenic
1077490758 11:2859873-2859895 CTTTTGGAAGAGGAGCATCATGG - Intergenic
1077993531 11:7433131-7433153 CAAATGGCAGAGCAGGAGCAAGG - Intronic
1079326010 11:19493208-19493230 CTATTGGAGGAGAAGGATAATGG - Intronic
1079474060 11:20809524-20809546 TTATGGGAAAAGGAGAAGCAAGG - Intronic
1079786521 11:24680073-24680095 TTACTGGTAGTGGAGGAGCAAGG + Intronic
1080918829 11:36688319-36688341 CTACTGGAAGAGGAGGGAGAGGG - Intergenic
1081565841 11:44260583-44260605 TTTTTGGGAGAGGAGGAACACGG - Exonic
1081735919 11:45404232-45404254 GTATTAGAAGAGGTGGAGGAAGG - Intergenic
1082798686 11:57397563-57397585 CTATGGTAAGAGGAGGAAGAGGG - Intronic
1083533541 11:63447622-63447644 CTGTTGGAAGAAAAAGAGCAAGG + Intergenic
1084437947 11:69155083-69155105 CTACTGGAAGCGAAGGTGCAGGG + Intergenic
1084479976 11:69414449-69414471 CTTATTGAAGAGGATGAGCAAGG + Intergenic
1084739745 11:71131938-71131960 CAGCTGCAAGAGGAGGAGCAGGG + Intronic
1084760678 11:71268735-71268757 CTTTGGGAGGAGGAGGAGAAGGG + Intergenic
1085778849 11:79390349-79390371 CTTTTGGAAGAAGAGCAGAAGGG - Intronic
1086098018 11:83069971-83069993 CTAGTTGAAGTGGAGGACCAGGG + Intronic
1087597420 11:100272066-100272088 CAATAGAAAGAGGAGGATCAGGG + Intronic
1087679409 11:101202816-101202838 CTGTTGGATGAGAAGCAGCATGG + Intergenic
1088658139 11:112021185-112021207 CTTTTGGAAAAGGAGCTGCATGG + Intronic
1088672434 11:112155743-112155765 GTATTGGAAGAGGGGCAGAAAGG - Intronic
1088878134 11:113952587-113952609 CTCTTCAAAGAGGATGAGCAGGG - Intergenic
1088923757 11:114280684-114280706 CTTTGGGAAAAGGAGGAACAAGG + Intronic
1089665753 11:120017600-120017622 TTGTTGGAAGAGGAGGAATAAGG - Intergenic
1090527233 11:127550311-127550333 AGATTGGAAGATCAGGAGCATGG - Intergenic
1090662740 11:128893287-128893309 TTCTTGGAAGAGCAGCAGCAGGG + Intronic
1090931370 11:131300684-131300706 ATGTTGGAAGGGGAGGAGGAGGG - Intergenic
1091069443 11:132549438-132549460 CCATTGGCAGAGCAGCAGCATGG - Intronic
1091926542 12:4355872-4355894 CTCTGGGGAGAGGAGCAGCATGG + Intergenic
1092930370 12:13309853-13309875 CTATTGGAGGGGAAGGAGGAAGG - Intergenic
1094476870 12:30847153-30847175 CTATGGGAAGAGGAGAGGCCTGG - Intergenic
1096229467 12:49889107-49889129 ATATTGGAAGGGTAGGAGGATGG + Exonic
1096244491 12:49976524-49976546 CTATTGGGAGAGGCCGGGCACGG - Exonic
1096546641 12:52344705-52344727 CAAATGAAACAGGAGGAGCAAGG + Intergenic
1097832821 12:64243477-64243499 ATATTGCAAGAGGAGGAGGGTGG - Intergenic
1097889455 12:64762398-64762420 AGATTGGAAGAGGACAAGCATGG + Intergenic
1098873808 12:75845974-75845996 TTATTGGAAGAGAAGGAACGTGG - Intergenic
1100369035 12:93948523-93948545 CTATTTGAAAAGTGGGAGCATGG - Intergenic
1102049108 12:109849507-109849529 CTAGTAGAAGAGGAGGGTCAGGG - Intergenic
1102122598 12:110453988-110454010 TTACAGGAAGAGGAGGAGAAGGG + Intronic
1102748541 12:115271758-115271780 AGAGTGGAAAAGGAGGAGCAGGG - Intergenic
1102912339 12:116726550-116726572 TTATTGCAAGAAGAGGAGCTAGG + Intronic
1103366747 12:120389463-120389485 CTGTTAGAAGAGGAGGGGGAGGG + Intergenic
1104504002 12:129313315-129313337 TTATGGGAAGAGTAGGAGGACGG - Intronic
1105851525 13:24340195-24340217 CTGAGGGAAGGGGAGGAGCAGGG + Intergenic
1106142912 13:27026085-27026107 CTGTTAGAAGAGGAGTTGCAAGG - Intergenic
1106270283 13:28146380-28146402 CTATGGGGGGAGGAGGGGCAGGG - Intronic
1108754077 13:53478611-53478633 ATAGTGGAAGAGGAAGAGAAGGG - Intergenic
1109447382 13:62459874-62459896 TTATGGGAAGAGGGGGATCAGGG - Intergenic
1109526842 13:63586666-63586688 ACATAGGAAGAGGAGGAGCTAGG + Intergenic
1110060141 13:71030275-71030297 TTATTGGAGGAGGAGGCTCAGGG + Intergenic
1110622457 13:77612509-77612531 GTTTTGGAAGAAGGGGAGCAAGG + Intronic
1111260859 13:85738136-85738158 ACATAGGAAGAGGAGGAGCTAGG - Intergenic
1113574638 13:111385947-111385969 CTATTGGAAATGAAGGAACAGGG + Intergenic
1114795985 14:25715331-25715353 CTATGGGAGAAAGAGGAGCAGGG + Intergenic
1117154021 14:52919845-52919867 CTAGGTGAAGAGGAGGAACAGGG + Intronic
1117850622 14:59965252-59965274 AAATTGGAGGAGGAGGAGCAGGG - Intronic
1118227839 14:63919600-63919622 CAAGTGGAAGAGGAGGAACAAGG + Intronic
1118395766 14:65335138-65335160 CTCCTTGAACAGGAGGAGCAAGG - Intergenic
1119937948 14:78610377-78610399 CCCTTGGAAGAGCAGGAGCCTGG - Intronic
1121610041 14:95272303-95272325 CTCCAGGAAGAGGAGGAGGAGGG + Intronic
1202870808 14_GL000225v1_random:161645-161667 CTAAAGGAAGAGGAGGAGGGGGG + Intergenic
1126370869 15:47945857-47945879 TTAATGGAAGTGGAGGACCATGG + Intergenic
1127824718 15:62692715-62692737 GTATTTAGAGAGGAGGAGCAGGG + Intronic
1128243499 15:66117473-66117495 CTCTTGGAAAATGAAGAGCAGGG - Intronic
1128861980 15:71081833-71081855 CTAGTGGCACAGGAGGAGCATGG + Intergenic
1129907297 15:79197423-79197445 CTCATGGAAGAGGAGCAGCAGGG + Intergenic
1130990866 15:88874969-88874991 GTATTGGATGAGAAGGAGCCAGG + Exonic
1133687865 16:8183485-8183507 CAACTGCAAGAGGAGGAGCTGGG - Intergenic
1135206200 16:20486261-20486283 TGATTGGTAGAGGAGGAGCTGGG + Intronic
1135212722 16:20537652-20537674 TGATTGGCAGAGGAGGAGCTGGG - Intronic
1135967069 16:27044645-27044667 CTTGAGGAAGAGGAGGAGGAAGG - Intergenic
1136359652 16:29770585-29770607 CTATTTGAAGAGGAGGAGCTGGG + Intergenic
1136990802 16:35150381-35150403 ATATTGGAAATGAAGGAGCAGGG - Intergenic
1137910100 16:52369232-52369254 CTACTGGAAGAGCAGGATAAAGG - Intergenic
1137996269 16:53217495-53217517 CTTTTGGAAGCCGAGGAGAAAGG - Intronic
1138005812 16:53336474-53336496 CTCTTAGAAGAGGCTGAGCACGG + Intergenic
1138750909 16:59420099-59420121 GAATTGGAAAAGGTGGAGCAAGG - Intergenic
1140523461 16:75602150-75602172 CTCTTGGGAGAGGAGGAGGTTGG + Intronic
1141252233 16:82369266-82369288 GTGATGGAGGAGGAGGAGCATGG - Intergenic
1141694159 16:85612075-85612097 GTGTTGGAAGAGGATGAGGAGGG + Intronic
1141775574 16:86120914-86120936 CTAGAGGAGGAGGAGGAGAAGGG - Intergenic
1142676972 17:1519686-1519708 CAAAGGGAAGAGGAGGAGCAGGG + Exonic
1142863550 17:2777392-2777414 CTATTGCAGGAAGAGGAGCTAGG + Intronic
1143129975 17:4671953-4671975 CTTTTGGAAGTGGAGGAGCCAGG - Exonic
1143391578 17:6561823-6561845 GGATGGGAAGAGGAGGAGGAAGG - Intergenic
1144011425 17:11151753-11151775 GTATAGGAAGAGGATGTGCAAGG - Intergenic
1144952564 17:19002118-19002140 TTAGAGGAAGAGGAGGAGGAGGG - Intronic
1146197176 17:30824054-30824076 ATATTGGAAGGGGAGGACTAAGG - Intronic
1146401754 17:32505144-32505166 CTATTGGCAGGGGAGCCGCAGGG - Intronic
1146626904 17:34441856-34441878 GTATGGGGAGAGGAGGAGGAGGG + Intergenic
1147034742 17:37671592-37671614 GTGTTTGCAGAGGAGGAGCAGGG - Intergenic
1147864291 17:43542802-43542824 CAATTTGAAGAGAAGCAGCAGGG - Intronic
1147874133 17:43608791-43608813 TTAATGGAAGAAGAGGAGGATGG + Intergenic
1147877190 17:43629953-43629975 CACTAGGAAGAGGAGGAGCTGGG + Intergenic
1149550221 17:57534319-57534341 CAAGTGGAAATGGAGGAGCACGG - Intronic
1149567364 17:57649737-57649759 CTAATGGAACAGGAGGGGGATGG + Intronic
1150017580 17:61573772-61573794 CTATTGGAAGGGATGGAGGAAGG - Intergenic
1150178354 17:63087187-63087209 CTGTTGGAAGAGACAGAGCAAGG - Intronic
1150267160 17:63838971-63838993 GGATGGGGAGAGGAGGAGCAGGG + Intronic
1152063763 17:78098545-78098567 CCATCGGAACACGAGGAGCATGG - Intronic
1153751081 18:8231333-8231355 CAATTGGGAGAGGAGCAGGATGG - Intronic
1155410576 18:25540336-25540358 CTATAGGAAGAAGAGCAGAAAGG + Intergenic
1156304405 18:35863426-35863448 CTGTAGGATGAAGAGGAGCAAGG + Intergenic
1156561406 18:38129843-38129865 CCATAGGCAGAGGAGGAGCAGGG + Intergenic
1157247796 18:46069824-46069846 CTATTGATGGAGGAGGAGAAAGG - Intronic
1157284752 18:46370072-46370094 CAAAGGGAAGAGGAGCAGCAAGG - Intronic
1157680455 18:49601492-49601514 CTACGGGAACAGGAGGTGCAAGG + Intergenic
1158732965 18:60045881-60045903 CTATGGAAAGAGGAGAAACATGG + Intergenic
1158886230 18:61829693-61829715 GGATTGGAAGAGGAGGGGAAAGG - Intronic
1159586655 18:70288980-70289002 CTCCTGGAGGAGGAGGAGGAAGG + Exonic
1159933357 18:74337779-74337801 CTAATGGAAATGGAGGAGCAGGG - Intronic
1163801053 19:19365819-19365841 ATATTGAAAGAGGAGGGACACGG + Intergenic
1164419463 19:28075921-28075943 CTCATGGAAGAGGAGGATGAGGG + Intergenic
1165595682 19:37009839-37009861 CCAGTGGAAGAGGAGGTTCAGGG - Intronic
1165865225 19:38932822-38932844 CTGATGGAAGAGGCGGAGCCAGG - Exonic
1167124319 19:47538971-47538993 CTAGAGGATGAGGAGGAGTAGGG - Intronic
1168182354 19:54670975-54670997 CCATGGAAAGAGGAGGAGGAAGG + Intronic
927281999 2:21317224-21317246 TAATTGGGAGAGGATGAGCAGGG + Intergenic
927811065 2:26180387-26180409 CTCAGGGAAGAGGAAGAGCAGGG - Intronic
928374259 2:30762339-30762361 CTCATGGAAGAGGAGGAGGCTGG - Intronic
928952626 2:36826510-36826532 CTAGAGGAAAAGAAGGAGCAGGG - Intergenic
928979373 2:37122313-37122335 CTGCAGCAAGAGGAGGAGCAAGG + Intronic
930391044 2:50762024-50762046 CTTCTGCAAGATGAGGAGCAAGG - Intronic
930865723 2:56120430-56120452 CTTTTGGAAGGGAAGGAGGAGGG - Intergenic
931237478 2:60423670-60423692 ATGTTGGAATAGGATGAGCAAGG + Intergenic
931983625 2:67720858-67720880 CTATTCCAAGAGCAGCAGCATGG - Intergenic
931988399 2:67764029-67764051 CTGTTGGAAGAGAAGTAGCAAGG - Intergenic
932387988 2:71356091-71356113 CTATGGGAAGAGGTGGAGATAGG - Intronic
934983249 2:98865147-98865169 CTATTGGTGGAGGGAGAGCAGGG - Intronic
934994740 2:98947289-98947311 CTATTGGGAGAGGAGGTGGCAGG - Intergenic
935584902 2:104791867-104791889 CTAATGGAAGAGAAGAAGCCAGG - Intergenic
935652025 2:105390502-105390524 CTCTTAGAAGATGAGGAACAAGG - Intronic
938991745 2:136636633-136636655 CTAGTGGAAGAAGAGGAACATGG - Intergenic
939212303 2:139192297-139192319 TTAAGGGAAGAGGAGGAGGATGG - Intergenic
939737901 2:145872239-145872261 CTTTTTGAAGAGGAGTGGCAAGG + Intergenic
941221026 2:162781511-162781533 CTAGTGGAAGAGAATGAGGAAGG + Intronic
941406085 2:165090674-165090696 CTATGAGAAGAGGAGGATCCAGG + Exonic
941429026 2:165389278-165389300 CTATGAGAAGAGGAGGATCCAGG - Exonic
941495644 2:166199193-166199215 CTATGAGAAGAGGAGGATCCAGG + Exonic
942782230 2:179657888-179657910 CACTTGGAAGTGGAGGAGAAGGG + Intronic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
944676418 2:202036407-202036429 CTCTTGCAAGAGGAGAGGCACGG + Exonic
944692827 2:202173035-202173057 ATATTGGAAGAGGAGGAAGTAGG + Intronic
945010778 2:205461259-205461281 CTCTGGGCAGAGGAGCAGCATGG + Intronic
945576888 2:211542354-211542376 GGAGTGGAAGAGGAGGAGAAAGG + Intronic
946788398 2:223273315-223273337 AGCTTGGAAGAGGGGGAGCAGGG + Intergenic
947375256 2:229489256-229489278 GTAATGGAAGAGGAAGAGCCAGG + Intronic
948058619 2:235027677-235027699 GAATTGGCAGGGGAGGAGCAAGG + Intronic
948468073 2:238161674-238161696 CAATGGCAAGAAGAGGAGCAGGG + Exonic
948496474 2:238353188-238353210 CTAGAAGAAGAGGAGAAGCATGG + Exonic
1168781453 20:494783-494805 ATGTTGGAAGAGCAGCAGCAAGG - Intronic
1169023899 20:2351082-2351104 CTAATGGATGAGGATGGGCAGGG + Intergenic
1169425629 20:5495142-5495164 CTACAGGAGGAGGAGCAGCAGGG + Intergenic
1169880274 20:10340140-10340162 ATATGGCAAGAGCAGGAGCAAGG + Intergenic
1170342792 20:15348163-15348185 CTAATAGGAGAGGAGAAGCATGG - Intronic
1170529309 20:17274352-17274374 CTATGGATAGAGGAGGAGCCAGG - Intronic
1170579101 20:17684583-17684605 CTGTTGGCAGATGAGGGGCAAGG - Intergenic
1170579949 20:17691222-17691244 AAATGGGAAGAGGAGGAGCTTGG - Intergenic
1171391729 20:24805780-24805802 CTATTGGTGGAGGATGAGCAGGG + Intergenic
1173330738 20:42074358-42074380 CTCTTGGATGTGGAGGAGAAAGG - Exonic
1175228477 20:57459276-57459298 CTATTGGAAGGGGAGGTGGGAGG - Intergenic
1175577087 20:60068218-60068240 CTTTTGTATGAGGAGGGGCATGG + Intronic
1176130155 20:63493426-63493448 CTATGGGCTGGGGAGGAGCAGGG - Intronic
1176271684 20:64238703-64238725 CTCTGAGAAGGGGAGGAGCAGGG - Intronic
1177324254 21:19563438-19563460 CTTTGGGAGGAGGAGGAGAAAGG - Intergenic
1177953456 21:27567876-27567898 CTATTGGAATATGAGAAGCAAGG + Intergenic
1178156833 21:29863954-29863976 CTATTGGAACAGGAGGATGAAGG - Intronic
1178400601 21:32281768-32281790 CTATTGCCAGGGGAGCAGCACGG - Intergenic
1178537141 21:33419903-33419925 CTCTTGGAGGAGGAGGAGCGGGG + Intronic
1179179819 21:39035806-39035828 CAATTGGAAGAGGGGAAGGAGGG - Intergenic
1180870551 22:19144388-19144410 CTCGTGGAAGTGGAGGAGCCGGG - Intronic
1181361794 22:22343334-22343356 CTGTTGGAGGAGGAAGAGCAGGG - Intergenic
1181430596 22:22879324-22879346 TATTTGGAAGAGGAGGAGGAAGG - Intronic
1181973406 22:26711009-26711031 GTACTGGAAGAGGAGGAGGTTGG + Intergenic
1182548221 22:31087605-31087627 CTATTGTAGGAGGAGGAGGGAGG - Intronic
1182694314 22:32186254-32186276 AGAATGGAAGAGGAGGAGGAGGG - Intergenic
1183423208 22:37724162-37724184 CTATTGGGAGAGGAGGCTCTGGG - Exonic
1183423239 22:37724309-37724331 CTATTGGGAGAGGAGGCTCTGGG - Exonic
1183423361 22:37724888-37724910 CTATTGGGAGAGGAGGTCCTGGG - Exonic
1183583341 22:38738456-38738478 GATTTGGAAGAGGAGGAGCTAGG - Intronic
1184339627 22:43879164-43879186 GGATTGGAAAAGGAGGAGGAAGG - Intergenic
1184413429 22:44338617-44338639 CAGTTGGGAGAGCAGGAGCAGGG - Intergenic
1184688006 22:46105073-46105095 CTACTGGAAGGGCAGGTGCATGG - Intronic
949606906 3:5663093-5663115 CTAATGGCAGAGGACCAGCAAGG - Intergenic
949759106 3:7448514-7448536 CAGTTGGGAGAGGAGGAGTAGGG + Intronic
949881802 3:8667125-8667147 CCATTGGCAGAGCAGCAGCATGG + Intronic
950063171 3:10089342-10089364 GAATTAGATGAGGAGGAGCAAGG - Intronic
950220439 3:11191403-11191425 CTATGGGAAGAGGGGGAGGTGGG - Intronic
951662799 3:25088478-25088500 AGATTAAAAGAGGAGGAGCAAGG - Intergenic
951702073 3:25506849-25506871 CTACTGGTAGGGGAGAAGCATGG - Intronic
951766050 3:26200486-26200508 TTCTGGGAAGACGAGGAGCAGGG + Intergenic
953119131 3:40022660-40022682 CCAATGGCAGAGCAGGAGCAGGG + Intronic
956134480 3:66085457-66085479 CCTTTGGAGGAGGAGGAGAAGGG - Intergenic
956173210 3:66449475-66449497 CTAATGGAATAGCAGGAACAAGG + Intronic
960203183 3:114862812-114862834 CTTTTGGAAGCAGAGGAGAAGGG + Intronic
961192691 3:124975392-124975414 CTATTGGAAAAGGAAGAGAAAGG - Intronic
962130117 3:132663498-132663520 CTGTTGGAAGTGAAGAAGCAAGG - Intronic
962886062 3:139628953-139628975 CTAATGGAGCAGGAGGAGAAAGG + Intronic
963849276 3:150193784-150193806 CAATTGGAAGAGACAGAGCAAGG - Intergenic
964431022 3:156606060-156606082 CTCTGGGAAAAGGAGCAGCAGGG - Intergenic
965659519 3:171026776-171026798 GCATTGCAGGAGGAGGAGCAAGG + Intergenic
966523115 3:180894570-180894592 ATACAGGAAGAGGAGGAGCCAGG - Intronic
967163206 3:186757704-186757726 CCGTTTGAAGAGGAGGGGCAAGG + Intergenic
967252364 3:187553802-187553824 CTATTGGAGGAGGAGGTACTAGG + Intergenic
967940303 3:194761269-194761291 CTATTGGAAGTGGGGAAACATGG - Intergenic
968516638 4:1018309-1018331 CTAGGGAAGGAGGAGGAGCAGGG - Intronic
968629363 4:1642186-1642208 CTATTAGGGGAGGAGGTGCAAGG - Intronic
968837443 4:2975460-2975482 CTTTTAGAAAAGGAGGAGCAGGG + Intronic
970339582 4:15091168-15091190 ATCTTTGAAAAGGAGGAGCATGG - Intergenic
970570655 4:17378440-17378462 CAGTAGGAAGTGGAGGAGCAGGG + Intergenic
972945315 4:44247160-44247182 GTATTGGAAGAGGCATAGCATGG - Intronic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
975394626 4:73860731-73860753 ATAGTGAAAGAGGAGGAACAAGG - Intergenic
976009417 4:80468946-80468968 ATAATGAAAGAGGAGGAGCCAGG - Intronic
976589095 4:86831382-86831404 TTCTTGGAAGAGTAGGAGGAAGG - Intronic
977015435 4:91686888-91686910 CTTTTGCAAGCTGAGGAGCAAGG - Intergenic
983165267 4:164468592-164468614 CTATTGGCAGAGGAGAGGTAAGG + Intergenic
984208795 4:176820032-176820054 ACATTGGAAAAGGAGGATCAAGG + Intergenic
984799951 4:183705561-183705583 GTATTGGAAGAGGTGATGCAGGG - Intronic
985620216 5:951025-951047 CTATTTAAAGAGGAGGACCTAGG - Intergenic
986667512 5:10116270-10116292 TTATAGGAGGAGGAGAAGCAGGG + Intergenic
988050049 5:26015866-26015888 CTTCTGGAAGCTGAGGAGCAAGG - Intergenic
988074205 5:26332104-26332126 ATACAGGCAGAGGAGGAGCATGG + Intergenic
991053347 5:62295897-62295919 CAATGGGAAGAGGAGCAGTATGG + Intergenic
992608947 5:78490770-78490792 ATACTGCAAGAGGAGGAGGAGGG + Intronic
993043108 5:82837567-82837589 CTGTTAGAAAAGGAGGAGAAAGG + Intergenic
993047549 5:82885249-82885271 CCAGAGGAAGAGGAGGAGCAAGG + Intergenic
993455125 5:88119282-88119304 CTAATGAAAGAGGAGCAGAAAGG - Intergenic
994100212 5:95883264-95883286 CCTTTGGGATAGGAGGAGCAAGG + Intergenic
995725115 5:115173775-115173797 CTATTGAAAAAGGAGGTGCTAGG - Intronic
996600680 5:125259453-125259475 TTATTGGATGAAGATGAGCAAGG - Intergenic
996700037 5:126441557-126441579 ATATGGGAAGAAGAGGAGAAAGG - Intronic
998473742 5:142403697-142403719 TGTTTGAAAGAGGAGGAGCAGGG - Intergenic
998638286 5:143981550-143981572 CTGTTGGAGGAGTATGAGCATGG - Intergenic
999368514 5:151038588-151038610 CTGATGGGAGTGGAGGAGCACGG - Intronic
1000545909 5:162601948-162601970 CTACTGGAAGAGGAGGGGAAAGG + Intergenic
1001268141 5:170290121-170290143 CTTTTGGAAAAGGTGGAGGAGGG - Intronic
1001736412 5:174007408-174007430 CCATTGTTAGAGCAGGAGCATGG + Intergenic
1001740066 5:174045784-174045806 CAATTTGAAGAGGAGGAGGACGG - Exonic
1003130572 6:3392071-3392093 CTGTAGGAAGAAGGGGAGCATGG - Intronic
1003385315 6:5661975-5661997 CACTTGGAAGAGGGTGAGCAGGG + Intronic
1003732382 6:8839754-8839776 GTTTTGGAAAAGGAGGAGCTAGG - Intergenic
1006698608 6:35953299-35953321 CTACAAAAAGAGGAGGAGCAAGG + Intronic
1006934077 6:37705390-37705412 GTATTGGAAGGGGAGGGGCCGGG + Intergenic
1007870683 6:45034145-45034167 CTGTTGGAGGAGGAGGAGGTAGG - Intronic
1008453150 6:51676038-51676060 CTGGTGGCAGAGGAGGAGGAAGG + Intronic
1009358891 6:62789579-62789601 CTAAAGGTGGAGGAGGAGCAGGG + Intergenic
1009618135 6:66037662-66037684 CTGTTGCAAGAACAGGAGCAAGG + Intergenic
1010083514 6:71888801-71888823 TTTTTGGATGAGAAGGAGCAGGG - Intronic
1010795794 6:80115037-80115059 GTATTGGCAGAGGATGAGGAAGG - Intronic
1011531426 6:88326473-88326495 GAATTGGAAGAGAAGGAACAGGG - Intergenic
1011554562 6:88561200-88561222 CTCTTGGGAGAGGGGGAGGAAGG - Intergenic
1013699668 6:112750070-112750092 CTTTTGCAAGTTGAGGAGCAAGG + Intergenic
1013812906 6:114064845-114064867 CACCTGGAGGAGGAGGAGCAAGG + Intronic
1013944992 6:115711945-115711967 CCAATGGAATAGGAGAAGCAAGG - Intergenic
1014817469 6:125951681-125951703 CTATTGGAGGATGTCGAGCAGGG + Intergenic
1015940908 6:138450989-138451011 CTATTGGAAGAGGAGGAGCAGGG - Intronic
1017099152 6:150832169-150832191 ATCTTGGAAGAGAAGAAGCAAGG + Exonic
1017396881 6:154011067-154011089 TTGCTGGAAGAGGAGGAGTAAGG + Intronic
1017644452 6:156526330-156526352 CCAGCTGAAGAGGAGGAGCAGGG + Intergenic
1017869468 6:158474555-158474577 CTTTTTGAAGAGAGGGAGCAGGG - Intronic
1018304879 6:162444548-162444570 CAATAGGAAGAGGAGAAGGAGGG - Intronic
1018450960 6:163907096-163907118 ATATTGAAAGAATAGGAGCAAGG + Intergenic
1019169692 6:170125907-170125929 CAGCTGGACGAGGAGGAGCAGGG - Intergenic
1019379634 7:714083-714105 TAATTGGAGGAGGAGGAGGAGGG - Intronic
1021136366 7:16969277-16969299 GTAGTGGATGAGGAGAAGCAAGG + Intergenic
1021211748 7:17862770-17862792 TTATTGGAGGAGGCCGAGCAAGG + Intronic
1022027897 7:26465914-26465936 CTAAAGGAACAGAAGGAGCAAGG + Intergenic
1022969934 7:35507612-35507634 CAACTGGAAGAAGAGGAGGAAGG - Intergenic
1023107015 7:36772542-36772564 CTCTTGGAAGAGTAGGAATAGGG - Intergenic
1023532915 7:41176996-41177018 CTTTTGGAGGAGGAGAAGGAGGG + Intergenic
1025157388 7:56620603-56620625 CTCTTGGCAGGGGAGGAGCCTGG + Intergenic
1025216386 7:57060310-57060332 ATCTAGGAAGTGGAGGAGCAGGG + Intergenic
1025627132 7:63232753-63232775 ATCTAGGAAGTGGAGGAGCAGGG + Intergenic
1025654994 7:63510420-63510442 ATCTAGGAAGTGGAGGAGCAGGG - Intergenic
1025758376 7:64367500-64367522 CTTTTGGCAGAGGAGGAGACTGG - Intergenic
1026180244 7:68033019-68033041 CTATTGGGAGATGAGGATGAAGG - Intergenic
1026405028 7:70056226-70056248 CTTTGGGAAGATGAGGAGGATGG - Intronic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1027498156 7:78913912-78913934 TTATTGGGAGGGTAGGAGCATGG - Intronic
1028348951 7:89819534-89819556 CTATTGGGAGAGATGGAGCTGGG - Intergenic
1028419678 7:90618915-90618937 CTTTTTGATGAGAAGGAGCAGGG + Intronic
1030067944 7:105674758-105674780 CAAATAGAAGAGGAGGAGGAAGG - Intronic
1031474279 7:122204098-122204120 CTTCTGGATGATGAGGAGCATGG + Intergenic
1031516000 7:122699797-122699819 ATTTTGAAAGAGGAGGAGAAAGG + Intronic
1032098716 7:128954880-128954902 CAATTGGAAGAAGAGGGTCAGGG - Exonic
1032553037 7:132803740-132803762 CTATTGGAACTAGAGGAGAAAGG + Intronic
1032876743 7:136046090-136046112 CCATGGGAAGAAGAGAAGCAGGG - Intergenic
1034631171 7:152531628-152531650 CCATTGGAACAGGTGGAGCAAGG - Intergenic
1035679904 8:1480309-1480331 GTCTTGGAAGAGGAAGAGGATGG + Intergenic
1036474044 8:9077018-9077040 ACATTGGAAGGGGAAGAGCATGG - Intronic
1037935679 8:22913581-22913603 CTGAGGGAAGAGGAGGAGGAAGG - Intronic
1038013982 8:23497818-23497840 CTATTGGCAGGAGAGGAGCATGG - Intergenic
1038378835 8:27072804-27072826 CTATTGGATGTAGAGCAGCAGGG - Intergenic
1038461104 8:27717844-27717866 CATTAGGAAGAGGAGGGGCATGG - Intergenic
1039218453 8:35300052-35300074 CTATAGGAAGTGGATGAGGAAGG + Intronic
1039661535 8:39472212-39472234 CTTTTGGAAGAAGAGAGGCAGGG - Intergenic
1040374499 8:46810830-46810852 CTTTTGGCAGGGGAGGAGCCTGG - Intergenic
1042610556 8:70595247-70595269 CTTCTGGAGGAGAAGGAGCAGGG - Intronic
1043376150 8:79651972-79651994 CTATGGGAGGAGGAGCAGGAAGG + Intronic
1044413369 8:91909746-91909768 CTGCTGGAAGAGGAGGAGGAAGG + Intergenic
1045089226 8:98722425-98722447 CTAATGGAAAAGGAGGAGAGTGG + Intronic
1045113040 8:98951356-98951378 TGATTGGAAGATTAGGAGCACGG + Intronic
1046067131 8:109210885-109210907 CCATGGGAAGAGGAGTAGCCAGG - Intergenic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047529794 8:125664505-125664527 CTTTTGGAAAAGGAGGATGATGG - Intergenic
1047718179 8:127614983-127615005 CTAATTGATGAGGAAGAGCAGGG - Intergenic
1048115233 8:131514232-131514254 CTATGGCAAAAGCAGGAGCAAGG - Intergenic
1048877561 8:138848997-138849019 CAAGTGGAAGAGGCGGAGGAGGG + Intronic
1049282739 8:141758746-141758768 AAATTGGAGGAGGAGGTGCAGGG - Intergenic
1053215225 9:36265220-36265242 CTATTGGAAGACGTGGGTCATGG - Intronic
1055108478 9:72536865-72536887 CTATTGGAGGTGTGGGAGCAGGG - Intronic
1055255815 9:74369629-74369651 GTATGGGTAGGGGAGGAGCAGGG + Intergenic
1056662322 9:88553386-88553408 CTATTTGGGGAGGAGAAGCATGG - Intronic
1057571627 9:96208259-96208281 CAAATGGAACAGGAGAAGCAAGG - Intergenic
1057897968 9:98924741-98924763 CTATTGGGAAAGGAGGGGGAGGG + Intergenic
1058007502 9:99933682-99933704 CTATTGGTGGGGGAGTAGCAAGG - Intronic
1058130759 9:101250323-101250345 CTCTTTGAAAAGGAGGAGGATGG - Intronic
1058913174 9:109539959-109539981 CTAGTGGGAGAGGAAGAGAAAGG + Intergenic
1059493679 9:114691520-114691542 CTTTTGGAAGAGAAGGAGGAAGG + Intergenic
1059665447 9:116442297-116442319 CTAAGGGAACAGGAGGAACATGG - Intronic
1060312835 9:122478315-122478337 CAATAGGAAGAGGAGAAGCTGGG + Intergenic
1060437503 9:123606909-123606931 TTCTTGGAAGAGGTGGAGAAGGG + Intronic
1060499386 9:124141527-124141549 CCATTGGCAGAGCAGCAGCATGG - Intergenic
1060979831 9:127785707-127785729 CCGTCGGAGGAGGAGGAGCAGGG + Intronic
1061967659 9:134025314-134025336 GAACTGGAAGAGGAGGAGGAGGG - Intergenic
1203733647 Un_GL000216v2:114940-114962 CTAAAGGAAGAGGAGGAGGGGGG - Intergenic
1185719518 X:2371077-2371099 CTATTGTAACAAGAGGAGGAGGG - Intronic
1186299590 X:8185334-8185356 CTATTGGCCTAGTAGGAGCAAGG + Intergenic
1186343857 X:8670817-8670839 CGACTGGAAGAGGAGCAGCCGGG - Intronic
1188864522 X:35299173-35299195 CTTTTGGTGGAGGCGGAGCAAGG + Intergenic
1189743126 X:44142231-44142253 CTATTGGCAGAGCAGTGGCATGG + Intergenic
1192565138 X:72157300-72157322 CGATGGGAGGAAGAGGAGCAGGG - Intergenic
1194402233 X:93452705-93452727 CTATTGCAAGGGCAGGACCAAGG - Intergenic
1194765954 X:97845511-97845533 CTATGGGAAGAAGTGTAGCAGGG - Intergenic
1196707047 X:118726001-118726023 CTTTTGGGAGGGAAGGAGCAAGG - Intergenic
1196745451 X:119067861-119067883 CCATGGGAAGAGTAGAAGCAAGG + Intergenic
1197426895 X:126307932-126307954 CTTCTGGAAGTGGAGAAGCAAGG + Intergenic
1198222258 X:134613375-134613397 CTATGGGCAGAGGCGGAGGAAGG + Intronic
1198638587 X:138728622-138728644 CTATTGGGAGAGGGGAAGGAGGG + Intronic
1199309221 X:146303172-146303194 TTAGAGGGAGAGGAGGAGCATGG + Intergenic
1199443837 X:147898320-147898342 CTTTTGGAAGAAGAGGATGATGG - Intergenic
1199735714 X:150684953-150684975 CCATTGGAGAAGCAGGAGCATGG - Intergenic
1201549376 Y:15203860-15203882 ATATTTGAGGAGGAGGAACATGG + Intergenic
1201793139 Y:17864431-17864453 CTATTGGAGGAGGAGAACCCTGG - Intergenic
1201808415 Y:18041555-18041577 CTATTGGAGGAGGAGAACCCTGG + Intergenic
1202354672 Y:24033684-24033706 CTATTGGAGGAGGAGAACCCTGG - Intergenic
1202516106 Y:25636425-25636447 CTATTGGAGGAGGAGAACCCTGG + Intergenic