ID: 1015942691

View in Genome Browser
Species Human (GRCh38)
Location 6:138467606-138467628
Sequence CAGTAGGACAAGATGTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015942685_1015942691 -10 Left 1015942685 6:138467593-138467615 CCCGAGGAACTTCCAGTAGGACA 0: 1
1: 2
2: 46
3: 387
4: 740
Right 1015942691 6:138467606-138467628 CAGTAGGACAAGATGTGGAGGGG No data
1015942684_1015942691 -9 Left 1015942684 6:138467592-138467614 CCCCGAGGAACTTCCAGTAGGAC 0: 1
1: 0
2: 6
3: 70
4: 498
Right 1015942691 6:138467606-138467628 CAGTAGGACAAGATGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015942691 Original CRISPR CAGTAGGACAAGATGTGGAG GGG Intronic
No off target data available for this crispr