ID: 1015945168

View in Genome Browser
Species Human (GRCh38)
Location 6:138492287-138492309
Sequence CATTGTACACACAGGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015945168 Original CRISPR CATTGTACACACAGGGAGAG AGG (reversed) Intronic
903515280 1:23906286-23906308 CATTTTACAGACAAGGACAGTGG - Intronic
904397292 1:30230374-30230396 CCCTGTCCCCACAGGGAGAGGGG - Intergenic
908000025 1:59670777-59670799 CTCTGTACAAGCAGGGAGAGCGG + Intronic
908865379 1:68542761-68542783 CATGGGACACACAGGGCCAGAGG + Intergenic
910140971 1:84027485-84027507 CAATTTACATACAGGGAGTGGGG + Intergenic
910140980 1:84027524-84027546 CAATTTACATACAGGGAGTGGGG + Intergenic
910141006 1:84027663-84027685 CAATTTACATACAGGGAGTGGGG + Intergenic
910782349 1:90953340-90953362 CATTTAACAGACATGGAGAGGGG + Intronic
912283002 1:108337077-108337099 CATTCTACAGGTAGGGAGAGAGG + Intergenic
912775013 1:112501349-112501371 TATTGTACAGACAGGGAGTGTGG - Intronic
913048306 1:115092046-115092068 CAGTGTGTACACAGCGAGAGTGG + Intergenic
915441031 1:155945621-155945643 CATTTCACACACAGGGACACAGG - Intergenic
918561186 1:185869287-185869309 CATTTTACAGACAGGGAAACTGG - Intronic
919696943 1:200587178-200587200 CATTGAAGACTCAGGGAGAGTGG + Intronic
919981785 1:202646376-202646398 CACAGGGCACACAGGGAGAGGGG - Intronic
920505072 1:206509569-206509591 AACCCTACACACAGGGAGAGAGG + Intronic
921271917 1:213477785-213477807 AATTATACATGCAGGGAGAGGGG - Intergenic
922005925 1:221530684-221530706 CATTCTACATCCAGGAAGAGTGG + Intergenic
922778199 1:228227254-228227276 CATTTTACAGACAGGGAAACAGG - Intronic
923119271 1:230975938-230975960 GATTGTACATACAAGGACAGTGG - Intronic
923656954 1:235925319-235925341 CCTCATTCACACAGGGAGAGGGG + Intergenic
1063604885 10:7514419-7514441 CATTGTAGAAACCAGGAGAGAGG - Intergenic
1065150352 10:22816598-22816620 GATTGTAAAGACAAGGAGAGAGG - Intergenic
1069873712 10:71548628-71548650 CTGTGTACACACAGAGACAGAGG + Intronic
1070374410 10:75815419-75815441 CCATGTACACAAAAGGAGAGGGG - Intronic
1072404096 10:95133428-95133450 CATTGCATACAAAGAGAGAGAGG + Intergenic
1072979227 10:100085806-100085828 CACTGTGCAAACAGGTAGAGAGG - Intergenic
1074850094 10:117432604-117432626 CATTGTACACACATTGTCAGGGG + Intergenic
1076129098 10:128000148-128000170 CATTTTAGAAACCGGGAGAGAGG - Intronic
1076141711 10:128084603-128084625 CATTGTACAGAGAAGGAGAGAGG - Exonic
1077715041 11:4572219-4572241 CATTGCTCCCACAGGTAGAGGGG + Exonic
1078000379 11:7490094-7490116 GATTGTCAACACAGGCAGAGGGG + Intronic
1078135352 11:8647578-8647600 CAGAGAACACACAGGGAAAGGGG + Intronic
1078958858 11:16239312-16239334 CATTGGAGAGAGAGGGAGAGGGG - Intronic
1079953515 11:26833881-26833903 GTGTGTACACACAGAGAGAGAGG + Intergenic
1084957132 11:72697462-72697484 CACTGTACATACAGGGCGAGCGG - Exonic
1085032386 11:73280660-73280682 CATTGTAAACTCAGGGACAGGGG - Intronic
1085206691 11:74737834-74737856 CATAGTGAGCACAGGGAGAGTGG - Intergenic
1087179692 11:95129389-95129411 CATGGTGTACACAGGGAAAGTGG - Exonic
1087334106 11:96821344-96821366 CATTGTTCATAAAGGGAGTGAGG + Intergenic
1089659811 11:119978543-119978565 CATTTCAAACACAGGGAGTGAGG + Intergenic
1090766474 11:129880400-129880422 TAATTTAGACACAGGGAGAGAGG - Intronic
1091533538 12:1383919-1383941 CATTTTACAGAGAGGGAAAGAGG + Intronic
1091945337 12:4535425-4535447 CATTGTACAAACAAGGAAACTGG - Intronic
1092241695 12:6839805-6839827 TATTGCACAGACTGGGAGAGAGG - Exonic
1093619580 12:21273134-21273156 CATTGTACACACAGTGAATTTGG + Intronic
1094033664 12:26043177-26043199 CTTTGAAAGCACAGGGAGAGTGG + Intronic
1094469724 12:30792815-30792837 CTTTGTACACTCTGGAAGAGTGG + Intergenic
1098877826 12:75884929-75884951 CATTATACACACAAGAAGAAAGG + Intergenic
1099197438 12:79634472-79634494 CAATGTACATTCAGGAAGAGGGG + Intronic
1099880313 12:88459514-88459536 GAGTGTACACACAGGGTGGGAGG + Intergenic
1100009631 12:89937840-89937862 ATTTGGACACACAGAGAGAGAGG - Intergenic
1100167928 12:91939379-91939401 AATTGTGGACATAGGGAGAGTGG - Intergenic
1101549675 12:105750340-105750362 ATTGGGACACACAGGGAGAGAGG + Intergenic
1102226582 12:111233059-111233081 CATTCTAGTCACAGGAAGAGAGG + Intronic
1104502187 12:129297016-129297038 CATTTTACCCAGAGGCAGAGAGG - Intronic
1107328074 13:39266773-39266795 CATGGTAGAGACAGAGAGAGAGG + Intergenic
1110001344 13:70206060-70206082 CATTCTACACAGAAGGAAAGTGG - Intergenic
1110259121 13:73465382-73465404 CATTGTACACACAAGTATATAGG - Intergenic
1111590638 13:90343810-90343832 CATTGCACACAAAGAGAAAGTGG + Intergenic
1113448970 13:110392512-110392534 GAGTGGACACACAGGCAGAGGGG - Intronic
1113603353 13:111586873-111586895 CACTGTTCATACAGGGAAAGAGG - Intergenic
1113627918 13:111859888-111859910 CATCTTACAGACAGGGACAGTGG - Intergenic
1114705456 14:24721948-24721970 CATTGGAATCACAAGGAGAGAGG - Intergenic
1115130211 14:30045675-30045697 CAGTTTGCACACAGAGAGAGAGG - Intronic
1118285778 14:64470660-64470682 AAGTGTAGAAACAGGGAGAGTGG + Exonic
1119743612 14:77028897-77028919 TGTTGTACACACACGGCGAGGGG - Intergenic
1121019016 14:90567626-90567648 CATTTTACAGATAGGAAGAGTGG + Intronic
1123662444 15:22576089-22576111 CATTGGAGAAACAGGGAGAGAGG - Intergenic
1123722573 15:23072541-23072563 CATTGTACACACAAGGAGACAGG + Intergenic
1124261845 15:28199815-28199837 TATTGGAGAAACAGGGAGAGAGG + Intronic
1124316244 15:28670373-28670395 CATTGGAGAAACAGGGAGAGAGG - Intergenic
1127828917 15:62732604-62732626 CATTCTACACACAGGAGGAAGGG - Intronic
1128383194 15:67128260-67128282 CATACTGCAAACAGGGAGAGCGG + Intronic
1128399989 15:67268764-67268786 CATTCTAGTCACAGAGAGAGAGG + Intronic
1128537473 15:68501739-68501761 CATTGGAAACACAGGCAAAGAGG - Intergenic
1128629832 15:69253324-69253346 CAGTGTTCCCACAGGGTGAGTGG - Intronic
1128730195 15:70015662-70015684 TTTGGTGCACACAGGGAGAGGGG + Intergenic
1129202454 15:74011774-74011796 CTTTGTACAAACAAGGCGAGAGG + Intronic
1130561496 15:84962866-84962888 CCTGGTACACTCAGGGAGAGTGG + Intergenic
1131002936 15:88952877-88952899 GATTGTACAAAAAGGGAGATGGG - Intergenic
1131561894 15:93451114-93451136 CATTTCACACCCAGGGAGACGGG - Intergenic
1131583455 15:93667994-93668016 TATTATATACACAGAGAGAGAGG + Intergenic
1133575610 16:7086356-7086378 CAATGTACAGAAGGGGAGAGGGG - Intronic
1133778722 16:8919755-8919777 CATTGTGTACAGAGGGAGATGGG - Intronic
1134410258 16:13998061-13998083 CATTCTAGACACAGGGAAACAGG + Intergenic
1136043221 16:27596549-27596571 TTTTGTACACAGAGGTAGAGTGG + Intronic
1136315644 16:29453450-29453472 CATTTTACAAGCAGGGATAGAGG + Intronic
1136430221 16:30192792-30192814 CATTTTACAAGCAGGGATAGAGG + Intergenic
1136654788 16:31703353-31703375 CATCATACCCACAGGGAGAAGGG - Intergenic
1137806155 16:51307445-51307467 TGTTGCACACACAGGCAGAGTGG + Intergenic
1138209088 16:55147869-55147891 GATTGCACAAGCAGGGAGAGAGG - Intergenic
1138240493 16:55423698-55423720 CTTTGGACACACGGGCAGAGTGG + Intronic
1138487090 16:57352769-57352791 CCTTGTAAGCCCAGGGAGAGGGG + Intergenic
1138778873 16:59758366-59758388 CATTGTAATCACAGAGAGAGAGG - Intergenic
1140613298 16:76627513-76627535 CATTGTACACACATGTACAATGG + Intronic
1141265658 16:82494568-82494590 GATAATAAACACAGGGAGAGGGG - Intergenic
1141287585 16:82687052-82687074 CATTGTACAAATGGGCAGAGAGG + Intronic
1141805906 16:86341343-86341365 CTGTGGACACACAGGGAGCGCGG + Intergenic
1143208298 17:5162482-5162504 CATTTTACAAACAAGGAGATAGG + Intronic
1144623351 17:16832120-16832142 CACTTTACAAACAGGGAGACTGG - Intergenic
1144883081 17:18440596-18440618 CACTTTACAAACAGGGAGACTGG + Intergenic
1145149150 17:20503790-20503812 CACTTTACAAACAGGGAGACTGG - Intergenic
1146467400 17:33096996-33097018 CATTTTACAGACAGGGAAACAGG + Intronic
1147577675 17:41612057-41612079 CACTTTACAAACAGGGAGACTGG - Intronic
1148130981 17:45262473-45262495 ACTTGTGCACACAGGGAGTGTGG + Intergenic
1148222072 17:45870046-45870068 CATTTTACAGACAGGGAAACGGG - Intergenic
1148555584 17:48577019-48577041 TACTGGACACACACGGAGAGAGG + Exonic
1148680994 17:49473376-49473398 CAATGTACACACAAGGGGATGGG + Intronic
1148787983 17:50155049-50155071 CATTGTCCCTGCAGGGAGAGGGG + Intergenic
1149380814 17:56092239-56092261 CAATGTAGGCACAGGGAGTGAGG + Intergenic
1149580112 17:57743960-57743982 CATGGTTCACACTGGGAGACTGG - Intergenic
1151903915 17:77035501-77035523 CATTTTACAAACAGGCACAGAGG + Intergenic
1152117148 17:78395412-78395434 CATTGTCAACACAGGAAGACAGG - Intronic
1153309651 18:3665832-3665854 TATTGTGCACTCAGGGAGGGAGG - Intronic
1154095744 18:11413588-11413610 CACTGCACTCACAGGGAGACAGG - Intergenic
1155341797 18:24820570-24820592 CACTGTACAAAAAGGGAAAGAGG - Intergenic
1156513086 18:37657827-37657849 CACTGGGAACACAGGGAGAGTGG + Intergenic
1158001455 18:52623917-52623939 TATTGAATACACAGGGAAAGAGG + Intronic
1158827870 18:61243789-61243811 CTTTGTATACATAGAGAGAGAGG + Intergenic
1159248022 18:65835313-65835335 TATTGTGGACACAGGGAAAGTGG + Intronic
1165072785 19:33265210-33265232 CATGGTTCACACAGGGAGCATGG + Intergenic
1165245168 19:34494456-34494478 AGGTGTGCACACAGGGAGAGAGG + Intronic
1167667758 19:50832661-50832683 CATGGGAGACCCAGGGAGAGGGG - Intronic
1167850944 19:52201464-52201486 CATTTTACAGACAGGGAAACAGG - Intronic
925362555 2:3289593-3289615 CATGGTGCACATAGGGAGACAGG - Intronic
926337512 2:11875287-11875309 CATGAGACCCACAGGGAGAGTGG - Intergenic
926913550 2:17873039-17873061 CAGTGTCCTCACAGGAAGAGGGG - Intergenic
927730587 2:25467988-25468010 CATGGTACACACAAGGGCAGCGG - Intronic
928893871 2:36238954-36238976 CATTGAGCACTCACGGAGAGTGG - Intergenic
929889125 2:45904988-45905010 CATTGTACAGACAGCGACAGGGG + Intronic
932009266 2:67958987-67959009 AATTGTACATTCAGGGAGTGGGG + Intergenic
932065939 2:68560117-68560139 GATTGAACATACAGGTAGAGAGG - Intronic
932178646 2:69625534-69625556 CATTTTACACATAGGGAGCCTGG + Intronic
932451289 2:71812311-71812333 CACTGGACACCCAGGAAGAGAGG + Intergenic
936507551 2:113119529-113119551 CATTGTACCCACTGGGGGACAGG - Intronic
936538646 2:113332333-113332355 CATTGTACCCACAGGTAGTGAGG - Intergenic
937925892 2:127166974-127166996 CATTCTACACACAGAGTGACTGG - Intergenic
938979729 2:136514642-136514664 CAGTGTCCAGACAGGGGGAGCGG + Intergenic
941226721 2:162858658-162858680 CTTTGTTCACAGAGGGAGACAGG + Intergenic
942987942 2:182164266-182164288 CATAGTACAAACTGGGAGAGAGG - Intronic
943820074 2:192311212-192311234 CATTATACATACAAAGAGAGAGG - Intergenic
944897607 2:204181041-204181063 CATTTTACACACAGGGAAATAGG + Intergenic
946861618 2:224005101-224005123 CATTGTAAAAACAGGGTGAAAGG + Intronic
948533786 2:238631417-238631439 CATTGCAGGCACAGGGAGGGAGG + Intergenic
1173880572 20:46408695-46408717 CATTGTACACATGAGGAGACAGG - Intronic
1174020254 20:47524308-47524330 CATGTTAGACACACGGAGAGAGG + Intronic
1174060815 20:47831632-47831654 CACTGGACACACAGACAGAGAGG - Intergenic
1174071083 20:47899738-47899760 CACTGGACACACAGACAGAGAGG + Intergenic
1174105055 20:48156026-48156048 CATGGGGCACACAGGGAAAGTGG + Intergenic
1174770737 20:53297727-53297749 CATTGTATACACAAGGAAAGTGG - Intronic
1175610132 20:60344254-60344276 CATTCTACACACAAGGACAGTGG + Intergenic
1175851845 20:62097892-62097914 CGTTTTACACACAGGCAGACAGG + Intergenic
1177749038 21:25256960-25256982 CATGCTACACTCAGGGACAGGGG - Intergenic
1177774754 21:25555532-25555554 CATTATAAAGATAGGGAGAGAGG + Intergenic
1178162394 21:29934345-29934367 CTTAGTACACACAGTGAAAGGGG + Intronic
1178349373 21:31861369-31861391 CATTGCACACAAAGGCACAGAGG + Intergenic
1178793473 21:35721993-35722015 CAGTGTAGCCACAAGGAGAGAGG - Intronic
1178966111 21:37119932-37119954 TACTGTACACACACTGAGAGAGG - Intronic
1179530584 21:42016102-42016124 CATTTTACACACCAGGAAAGGGG + Intergenic
1181350095 22:22248941-22248963 CATGGCAGAAACAGGGAGAGAGG - Intergenic
1181546401 22:23605059-23605081 CATTGTACAAATAGAGATAGAGG - Intergenic
1182220007 22:28751082-28751104 CATGGTACACACAGAGACAAAGG + Intronic
1183589682 22:38772741-38772763 CATTTTACCCACAAGGAGAATGG + Intronic
1185361140 22:50407715-50407737 CTGTGGACACACAGGTAGAGAGG + Intronic
949525574 3:4900172-4900194 GAGTGTATACAGAGGGAGAGAGG - Intergenic
949638144 3:6006898-6006920 AACTGTACACACAGTGAAAGTGG + Intergenic
950293787 3:11810065-11810087 CATTTCAAACACAGGGAGACTGG + Intronic
950672673 3:14536587-14536609 CCTCCTCCACACAGGGAGAGGGG + Intronic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
951854664 3:27181637-27181659 GATTGTAGACACAGGGAGACAGG - Intronic
954831301 3:53423521-53423543 CATTGTACAGAGAGGGAAAAAGG - Intergenic
955721475 3:61885995-61886017 ACATGCACACACAGGGAGAGAGG + Intronic
958016038 3:87941446-87941468 CCTTGTAGCCACAGGTAGAGAGG + Intergenic
959069532 3:101689458-101689480 CACTGTTCTCACAGGGACAGAGG - Intergenic
960536315 3:118818251-118818273 CATTTCACAGACAAGGAGAGAGG + Intergenic
960884877 3:122383860-122383882 CATTGAAAACACTGGAAGAGCGG + Intergenic
962013668 3:131419206-131419228 CATTGTACAGAAGGGGTGAGGGG + Intergenic
962595083 3:136934169-136934191 CATTGTACAAACAAGGATACTGG + Intronic
962679025 3:137779929-137779951 AACTGTAGCCACAGGGAGAGGGG - Intergenic
962769306 3:138597513-138597535 CATTGTGCACTCAGGGAGCTCGG - Intergenic
963224372 3:142846734-142846756 TATTGTACTCACAGGTAGATGGG - Intronic
966233528 3:177674717-177674739 CATAGTAGAGAGAGGGAGAGGGG - Intergenic
967270791 3:187730430-187730452 CATTTTACACATAGGGAAACAGG + Intronic
967950953 3:194840169-194840191 CATTTTACAGACAAGGAAAGTGG + Intergenic
967984211 3:195083276-195083298 CAGTTTACACACAGGTAGACAGG - Intronic
968485783 4:860695-860717 CACTGTGCACACGGGGAGAAGGG + Intronic
970531782 4:16992348-16992370 GATTCTATACACTGGGAGAGAGG + Intergenic
971104880 4:23513775-23513797 CATGGAACTCACAGGGAGAGGGG + Intergenic
971562320 4:28095801-28095823 CAATGCACCCACAGGGAAAGGGG - Intergenic
974855869 4:67459774-67459796 CATTGTGCAGTCAGGGAAAGGGG - Intergenic
975326960 4:73069521-73069543 CACTGCCCACACTGGGAGAGTGG + Exonic
975702252 4:77077243-77077265 CCTTTTATACACAGGGATAGAGG - Intergenic
976828153 4:89283490-89283512 CATGGTACACACAAGGTGGGTGG + Intronic
978122241 4:105093524-105093546 AATTGTACACTCAGGCACAGGGG - Intergenic
978269036 4:106865659-106865681 CATTTTACAGATTGGGAGAGTGG - Intergenic
979513844 4:121584433-121584455 CAGTGAAGACTCAGGGAGAGAGG + Intergenic
981019630 4:140011741-140011763 CAGTGCACAAACAGGCAGAGAGG - Intronic
981666418 4:147231986-147232008 CCTTGTACACCCAGGTAGAGGGG - Intergenic
982217762 4:153096918-153096940 AATTGTACAAACAGGCAGGGAGG - Intergenic
982865115 4:160500546-160500568 AATTATATACTCAGGGAGAGTGG - Intergenic
984029216 4:174582582-174582604 CATAGTAAACACAGGGGAAGTGG - Intergenic
984318587 4:178161418-178161440 CATTTTAGACACAGCTAGAGTGG + Intergenic
985753506 5:1698301-1698323 CAGTGTACACACAGAGGGAGTGG - Intergenic
988086651 5:26483025-26483047 CATTGTACTTCCAGGGATAGGGG + Intergenic
988365327 5:30290821-30290843 CATGGGACACACATGGAGAGGGG - Intergenic
990499699 5:56383925-56383947 CATGGTACGCCCAGAGAGAGCGG - Intergenic
991414559 5:66379141-66379163 CATTGTAGGCAGAAGGAGAGGGG + Intergenic
992377054 5:76198397-76198419 CAGAGAACACACAGTGAGAGAGG - Intronic
993218246 5:85053992-85054014 CATAGTACTGACAGGCAGAGTGG - Intergenic
995155411 5:108906092-108906114 CATTTTACACACTGGGAAATGGG - Intronic
995426892 5:112034588-112034610 CATTGAGCAAAGAGGGAGAGAGG - Intergenic
998372458 5:141670605-141670627 CATTGTACACACCAGGGGAGGGG + Exonic
1000597133 5:163229069-163229091 CATTTTGCACTCTGGGAGAGTGG - Intergenic
1000957523 5:167560455-167560477 GATTATAACCACAGGGAGAGTGG + Intronic
1001957202 5:175856169-175856191 CATTTTACAGAGAAGGAGAGAGG - Intronic
1006289533 6:33124022-33124044 AATTGCACACACAGAGAGAGAGG + Intergenic
1006454409 6:34123712-34123734 CATTTTACACACAAGGAAACGGG + Intronic
1006692389 6:35900228-35900250 CATTTTACACATAAGGCGAGAGG - Intronic
1007169389 6:39852060-39852082 CCTTGTCCCCACAGGAAGAGGGG + Intronic
1011557878 6:88588242-88588264 CATTGTGCACACAGGGACTCGGG - Intergenic
1011958047 6:93048407-93048429 AATTGTTGACACATGGAGAGAGG + Intergenic
1013285192 6:108675274-108675296 CAAGGGAGACACAGGGAGAGAGG - Intronic
1015191000 6:130472251-130472273 CCATACACACACAGGGAGAGAGG + Intergenic
1015945168 6:138492287-138492309 CATTGTACACACAGGGAGAGAGG - Intronic
1016786434 6:148015674-148015696 GAGTGTACCCAAAGGGAGAGAGG - Intergenic
1017396986 6:154012860-154012882 CATGACATACACAGGGAGAGAGG + Intronic
1017617266 6:156258750-156258772 CACTGTGGACACAGGCAGAGAGG - Intergenic
1018747615 6:166774638-166774660 AATTGTACAAACAGGGAAATTGG - Intronic
1018772830 6:166986843-166986865 CACTGTCCAGACAGGGAGAGAGG - Intergenic
1021508486 7:21410485-21410507 GATGGGACACACAGGCAGAGTGG + Intergenic
1021608487 7:22433310-22433332 CATTGTAACCCCAGGGAGAGAGG + Intronic
1021608521 7:22433489-22433511 CATTGTAACCCCAGGGAGAGAGG + Intronic
1022972748 7:35532343-35532365 CATTGCAGCCCCAGGGAGAGGGG + Intergenic
1023576768 7:41636215-41636237 CATTTTACACACAAGGAAACTGG + Intergenic
1024919128 7:54538821-54538843 CATTGTACACATATGGAAAGAGG + Intergenic
1026227230 7:68453054-68453076 CATTGTGTACAGAGGGTGAGGGG + Intergenic
1027545500 7:79522780-79522802 CATTATACACACAAGGAAAATGG - Intergenic
1030077109 7:105746226-105746248 CAGTGTAGACACAGGAAGGGTGG - Intronic
1030111359 7:106029797-106029819 CAGTGTACAAACAGGAAAAGAGG + Intronic
1032488577 7:132306844-132306866 CATTCTGCAGAAAGGGAGAGAGG + Intronic
1032608575 7:133386362-133386384 CCTTCTAAAAACAGGGAGAGAGG - Intronic
1033587725 7:142786866-142786888 CAGTGTTCACACAGTGACAGGGG - Intergenic
1033663246 7:143418215-143418237 GAATGTACACTCAGGGAGGGTGG - Intergenic
1034717516 7:153256999-153257021 CATTTTACAGAGAAGGAGAGTGG + Intergenic
1035470449 7:159105786-159105808 CATTGTGCAGACAAGGAGACAGG + Intronic
1036167617 8:6451342-6451364 CAATGTATAAACAGTGAGAGAGG + Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1039266179 8:35826584-35826606 CAGTGAACACACAGTGAAAGTGG + Intergenic
1040660975 8:49575062-49575084 CAGTCCACACATAGGGAGAGGGG - Intergenic
1042843499 8:73147906-73147928 CACTTTACACAAAGGGAGTGTGG - Intergenic
1047225338 8:122951832-122951854 CATTCTGCACACACGTAGAGGGG - Exonic
1047736259 8:127767817-127767839 CATGGTTCACACAGGAGGAGAGG - Intergenic
1047814799 8:128451875-128451897 GATTGAACACACAGTGAGGGTGG + Intergenic
1051464480 9:17361712-17361734 CACTTTCCAGACAGGGAGAGGGG - Intronic
1051617186 9:19017435-19017457 CATTCTACAGACAGGGACACTGG + Intronic
1051810877 9:21048348-21048370 AATTGTACACACAGGCTGGGAGG + Intergenic
1055319472 9:75068221-75068243 CATTCTCCACACAGCCAGAGGGG + Intronic
1055491283 9:76807639-76807661 CAAGATAGACACAGGGAGAGAGG + Intronic
1056071705 9:82993866-82993888 CATTTTACAGACAAGGAGACTGG - Intronic
1059618880 9:115981414-115981436 CATTGTGCATACAGCTAGAGAGG - Intergenic
1059679676 9:116573983-116574005 CATTGTACATCCAAGGTGAGAGG + Intronic
1059727020 9:117018874-117018896 CATTGTACAGACAAGGAAATTGG + Intronic
1060489582 9:124072768-124072790 CATTTTACAGACAGGGAAACTGG - Intergenic
1186072710 X:5839710-5839732 CACTGAAAACACAGTGAGAGGGG - Intergenic
1187749618 X:22447434-22447456 TCTTGTACAAAGAGGGAGAGAGG + Intergenic
1187990577 X:24867797-24867819 AATTGTACACACAGAGGGAAAGG + Intronic
1189545848 X:42042052-42042074 CTCTATACACACATGGAGAGAGG + Intergenic
1192222037 X:69203824-69203846 CATTGCACAGATAGGGAAAGAGG - Intergenic
1194048438 X:89037185-89037207 AATAATCCACACAGGGAGAGAGG + Intergenic
1194122255 X:89975753-89975775 CATGGCACACAAAGTGAGAGTGG - Intergenic
1194604935 X:95966677-95966699 GATTTTATTCACAGGGAGAGAGG - Intergenic
1194912860 X:99668395-99668417 CATTTTACAGAGAGAGAGAGAGG - Intergenic
1198120101 X:133583935-133583957 GATTCTGCACACAGGGACAGTGG - Intronic
1200475114 Y:3633188-3633210 CATGGCACACAAAGTGAGAGTGG - Intergenic
1201523279 Y:14901674-14901696 CACTGAAAACACAGTGAGAGGGG + Intergenic
1201533129 Y:15014387-15014409 CATGTTACACACAGCCAGAGAGG + Intergenic