ID: 1015948265

View in Genome Browser
Species Human (GRCh38)
Location 6:138524999-138525021
Sequence ATGTGTAAGTGGCAAATGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015948265 Original CRISPR ATGTGTAAGTGGCAAATGGG CGG Intronic
904038020 1:27569040-27569062 TTGAGTATGTGGCAAGTGGGCGG - Intronic
906604847 1:47161081-47161103 ATGTCTAAGTAGCAAATGAATGG + Intergenic
906670139 1:47648326-47648348 ATGAGAAAGGGGCAAATGGCAGG - Intergenic
906751158 1:48262427-48262449 ATGTGCAAGTGGAAAATGGATGG - Intergenic
908260397 1:62335763-62335785 ATGTGGAAGTGACAAGAGGGAGG + Intergenic
909494914 1:76267699-76267721 ATGTGTAATAGGCAAATGAAGGG + Intronic
909864122 1:80644930-80644952 AACTGTAAGTGCCAAATGAGTGG - Intergenic
910263104 1:85310647-85310669 ATATGTAAGTGGCAATTCTGAGG + Intergenic
910604284 1:89066617-89066639 ATGTGTAAGTGAGAAATGCTTGG - Intergenic
913287326 1:117238661-117238683 ATGTGTAAATTGGAAATGGTGGG + Intergenic
913551259 1:119919149-119919171 ATGGGAAAGTGGGAAAAGGGAGG - Intronic
916368545 1:164061783-164061805 CTGTGTCAGTGGGAAAGGGGAGG - Intergenic
916958110 1:169861380-169861402 ATGTGGAAATGTCACATGGGGGG + Intronic
918536935 1:185584984-185585006 ATGGCTAAGTGGGCAATGGGTGG - Intergenic
918686575 1:187423601-187423623 ATGTTTAGGTGGCAGTTGGGTGG + Intergenic
921614430 1:217249802-217249824 ATTTGTAAGTGGAAGATGAGTGG + Intergenic
924950581 1:248878812-248878834 TGGTGTATTTGGCAAATGGGTGG + Intergenic
1067400098 10:45964674-45964696 ATGTGTAAGTGGCAAAATGAAGG - Intergenic
1067868426 10:49933966-49933988 ATGTGTAAGTGGCAAAATGAAGG - Exonic
1071348115 10:84712759-84712781 ATGTGTATGTGGAGATTGGGTGG - Intergenic
1072553533 10:96496953-96496975 ATATGTGAATGGCAAATGTGTGG - Intronic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1075094962 10:119465280-119465302 ATGGGTAGGTGGTAGATGGGTGG + Intergenic
1075292749 10:121244239-121244261 ATGTGTCTGTGGCACCTGGGAGG - Intergenic
1080101782 11:28467616-28467638 AAATCCAAGTGGCAAATGGGAGG - Intergenic
1080225554 11:29956357-29956379 ATGTGTTAGAGGCAGATGAGAGG - Intergenic
1081148113 11:39589647-39589669 CAGTCTAAGTGGTAAATGGGAGG + Intergenic
1081531501 11:43963042-43963064 TTGTCTATTTGGCAAATGGGTGG + Intergenic
1082764351 11:57155369-57155391 ATGTGTTTGTGGCCAGTGGGTGG - Intergenic
1084257143 11:67950883-67950905 GTGCGTAAGTGGGAAATGGTGGG - Intergenic
1086061574 11:82705534-82705556 ATGTGTAAGTAGTAAAGGAGTGG - Intergenic
1087744230 11:101924798-101924820 ATGTATAACTGACAAATGGCAGG - Intronic
1088434963 11:109802234-109802256 ATTTGCAATTGGCAAGTGGGAGG - Intergenic
1090535383 11:127635680-127635702 AACTGTAAGTGGCAGATGGCCGG - Intergenic
1091992610 12:4968288-4968310 TTGGGTAAGTGGGAAAGGGGAGG + Intergenic
1092427376 12:8385669-8385691 GTGCGTAAGTGGGAAATGGTGGG - Intergenic
1093354029 12:18140928-18140950 ATGGCTAAGTAGCAAATGGGAGG + Intronic
1093396959 12:18694238-18694260 ATGTGTAAGTGCCCACTGGGTGG + Intronic
1095057509 12:37630990-37631012 ATCTGTAAGTGGATATTGGGAGG - Intergenic
1095318632 12:40797844-40797866 ACATCTAAGTGGCAGATGGGTGG + Intronic
1098969113 12:76830783-76830805 ATGTGTAAGTGGCAAGAAGCAGG + Intronic
1101220563 12:102634861-102634883 ATGTGTATGGGGCAGATGGGAGG + Intergenic
1101496935 12:105263618-105263640 ATGTGTAATGGGAACATGGGAGG - Intronic
1103744523 12:123113161-123113183 AAGTGTAAGTTCCAAATGAGTGG + Intronic
1105506895 13:21018014-21018036 ATATGGAAGTGGGAAATGTGAGG + Intronic
1107319962 13:39176098-39176120 ATATGTTAGTGGACAATGGGAGG + Intergenic
1111566860 13:90028009-90028031 AGGTGTAAGATGCAAATGGTTGG - Intergenic
1112430434 13:99346142-99346164 ATGTATAAGTGGGAAATGTCTGG - Intronic
1116157981 14:41232814-41232836 ATGTGTAAGGGTGAAGTGGGAGG + Intergenic
1119650414 14:76379037-76379059 ATGTGTTAGAAGCAAAAGGGAGG - Intronic
1119845630 14:77827586-77827608 ATGTTTAAGTGGCAAACTGAGGG - Intronic
1120978697 14:90272546-90272568 ATGTGTAAGTGCCCATTGGGTGG + Exonic
1121586595 14:95067210-95067232 AGAAGTAAGTGGGAAATGGGTGG - Intergenic
1121722653 14:96121495-96121517 ATGTGAAAATGGCAAGAGGGTGG + Intergenic
1122879870 14:104685917-104685939 GTGGGTGAGTGGCAAATGGGTGG + Intergenic
1126548303 15:49897735-49897757 ATTTGTAAGTGGCAAAGATGGGG + Intronic
1126950466 15:53874744-53874766 ATGTGGAAGTGCCAAGTGAGTGG - Intergenic
1127917365 15:63466125-63466147 CTGTATAAGAGGCAAATGTGTGG - Intergenic
1136746803 16:32597860-32597882 ATGGGTAAGTGGCACAGGGATGG + Intergenic
1136919282 16:34247770-34247792 ATCTGTAAGTGGAAACTTGGAGG + Intergenic
1137737710 16:50737237-50737259 AGGTGTGAGTGGCAAAGGGGAGG - Intergenic
1140287102 16:73614201-73614223 ATGTGTACGGGGCAAAAGTGAGG + Intergenic
1140714760 16:77712357-77712379 CTGTATAAGTGGTAATTGGGGGG - Intergenic
1142424848 16:89996549-89996571 ATGTGTGTGTGTAAAATGGGTGG + Intergenic
1203048933 16_KI270728v1_random:857064-857086 ATGGGTAAGTGGCACAGGGATGG + Intergenic
1144331614 17:14229322-14229344 ATCTGCAAGTGGAAAATGAGTGG - Intergenic
1145106755 17:20124155-20124177 ATGTGTAGATGGCAACAGGGAGG + Intronic
1145278541 17:21452547-21452569 ATGAGGAAGTGGGAAATAGGAGG + Intergenic
1147178979 17:38673417-38673439 CTGTGGAGGTGGCAGATGGGGGG - Exonic
1148200445 17:45746637-45746659 AAGTGCAAGTGGCACTTGGGAGG - Intergenic
1149215690 17:54351292-54351314 ATGTCTAGGTGACAAATAGGAGG + Intergenic
1150607693 17:66708261-66708283 AGGTGAAAGTGGCAAATGGCAGG - Intronic
1152001927 17:77651952-77651974 ATGTGCAAGTGACAGATGGGTGG - Intergenic
1152312418 17:79559260-79559282 ATGGGTAGATGGCAAATGGTGGG + Intergenic
1153344646 18:4012366-4012388 GTGTGGAAGTGGCAGAGGGGGGG - Intronic
1154056465 18:11017188-11017210 ATGTCTAATTGTCAAATGGATGG + Intronic
1155434813 18:25801374-25801396 ATGTGTAAGTGCCAAGAGGCAGG + Intergenic
1156772500 18:40746528-40746550 ATGGTTAAATGGCAAATTGGAGG - Intergenic
1156837347 18:41570024-41570046 AAGTGGAAGAGTCAAATGGGAGG + Intergenic
1157578696 18:48760766-48760788 CTGTTTTAGTGGCACATGGGAGG + Intronic
1159005970 18:63012190-63012212 ATGTGTATGTTGGAAAGGGGAGG - Intergenic
1159297687 18:66517513-66517535 ATGTGTAAGTGGCCAGGGTGGGG - Intronic
1159299963 18:66550573-66550595 AAGTGGAAGAGGCAAATGTGTGG + Intronic
1159948916 18:74464969-74464991 GTGTGTGTGTGGCAAGTGGGGGG + Intergenic
1162218425 19:9156146-9156168 ATGGGCAAGTGGAAAAGGGGTGG + Intronic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1165189389 19:34049685-34049707 ATGTGTAAGAGGGAAAAGGGTGG + Intergenic
1165659856 19:37568321-37568343 GTGTGTATATGGCAAGTGGGGGG - Intronic
925587031 2:5474807-5474829 GTGTGAACGTGGCAAGTGGGTGG - Intergenic
926868518 2:17386556-17386578 ATGTGTAAGTGCCCATTGGGTGG + Intergenic
926898518 2:17722565-17722587 ATGTGGAACTGGAAAATGTGAGG - Intronic
927620183 2:24647777-24647799 ATGTGAAAGTGGCAACTGGAAGG + Intronic
930134569 2:47888114-47888136 ATGTGTAAGTGCGAAGTGAGCGG - Intronic
931092902 2:58905625-58905647 ATGTGTGTGGGTCAAATGGGAGG + Intergenic
932360205 2:71098671-71098693 ATTTGTAAGTGGATAATGGAGGG + Intergenic
932716502 2:74103785-74103807 ATGTGTGTGTGGTGAATGGGGGG + Exonic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935830202 2:106994239-106994261 ATGGAGAAGTGGCAAATGTGTGG + Intergenic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
938052478 2:128187245-128187267 ATGTGTGAGTGGCTAATGGAAGG - Intronic
941862630 2:170299655-170299677 TTTTGTAACTGGCAAATGGCAGG + Intronic
942403914 2:175632717-175632739 ATTTGTAAGTTGGAAATAGGAGG + Intergenic
942886761 2:180934880-180934902 ATATGTAAGTACAAAATGGGAGG - Intergenic
942929406 2:181471692-181471714 GTGTGTAAGTGGGAAATTGGTGG - Intronic
943379221 2:187121691-187121713 ATGTGGAGGTGGGAGATGGGAGG + Intergenic
944245198 2:197523731-197523753 ATGTGTAAGTGCCCATTGGGTGG + Intronic
944614125 2:201442609-201442631 ATGTTTAAGAGGATAATGGGGGG - Intronic
947099410 2:226603742-226603764 ATTTGGAAGTAGCAATTGGGAGG + Intergenic
948148135 2:235723927-235723949 GTGTGAAAGTGGCAAAAGGAGGG + Intronic
1168891844 20:1300058-1300080 AGGTGTAAGTGGCAGATGCTGGG - Intronic
1168963407 20:1884030-1884052 ATATGTAGATGGCAAATGTGTGG - Intergenic
1173163200 20:40667546-40667568 ATGTGCAAGTGGCATGTGTGTGG + Intergenic
1175676476 20:60950397-60950419 ATGGGTAAGTGGATGATGGGTGG + Intergenic
1176295584 21:5070407-5070429 ATGTGTAAGTACCAGGTGGGTGG + Intergenic
1178053383 21:28771836-28771858 ATGTGTAAGTGGCAGACGACTGG - Intergenic
1178535460 21:33406539-33406561 ATGATTATATGGCAAATGGGTGG + Intronic
1179824934 21:43958688-43958710 GTGTGTATGTGGCATATGTGTGG + Intronic
1179824940 21:43958774-43958796 ATGTGTGTGTGGCATATGTGTGG + Intronic
1179861465 21:44191717-44191739 ATGTGTAAGTACCAGGTGGGTGG - Intergenic
1182309006 22:29391559-29391581 ATGTGCAAGTGGCAAGTCAGTGG + Intronic
1182361546 22:29749420-29749442 ATGTGTGAGGAGCAAAGGGGAGG - Intronic
1184912509 22:47545872-47545894 ATGTGTAAGCAGCTAACGGGAGG + Intergenic
949559847 3:5190782-5190804 GTTTGTAAGTGGCAAGTGTGAGG - Intronic
949905490 3:8855144-8855166 ATGTGTGAGTGGAAGAAGGGAGG - Intronic
950221054 3:11196359-11196381 GTGTGTTTGTGGCAAATGTGAGG - Intronic
950750415 3:15123837-15123859 GTGCGTAAGTGGGAAATGGTGGG + Intergenic
951274678 3:20671030-20671052 CTGTGGAAGTGGCAGATGGTAGG + Intergenic
952054660 3:29430108-29430130 ATGTGTATTTGGAATATGGGTGG + Intronic
952196421 3:31080336-31080358 ATATGTAAGTGGGAGGTGGGTGG - Intergenic
952248760 3:31628203-31628225 ATGTGTCAGTTAAAAATGGGGGG + Intronic
952588353 3:34920443-34920465 ATGTGTAAGTAGCTTATGTGAGG + Intergenic
954539661 3:51385187-51385209 ATGGGGAAGTGGCATGTGGGAGG + Exonic
954916608 3:54153385-54153407 ATATCTAAGTGAGAAATGGGTGG + Intronic
955324415 3:57999021-57999043 ATGTGCAATTTGCAAATGAGTGG - Intergenic
956246052 3:67184917-67184939 ATGTGTATATGGCAGATGGTGGG - Intergenic
956378128 3:68637166-68637188 ATGTGTAAGTGCCCATTGGGTGG + Intergenic
961282058 3:125771722-125771744 GTGCGTAAGTGGGAAATGGTGGG + Intergenic
961684359 3:128619047-128619069 GTGTGCAAGTGGTAAATGTGGGG - Intergenic
965120414 3:164547481-164547503 AAGTGTATGTGGCAAGTGGAAGG + Intergenic
966055510 3:175683533-175683555 AGGTATAATTAGCAAATGGGTGG + Intronic
969738290 4:9005677-9005699 GTGCGTAAGTGGGAAATGGTGGG + Intergenic
969797470 4:9537216-9537238 GTGAGTAAGTGGGAAATGGCGGG + Intergenic
971522487 4:27571486-27571508 ATATGTAAGTTGGAAATGTGCGG - Intergenic
971819574 4:31533711-31533733 ATGTGTAAGTGGCATTAGGCTGG + Intergenic
976310259 4:83604478-83604500 ATGTGTATTTGGCAAGTGGTAGG + Intronic
979802610 4:124928902-124928924 ATGTGTAAGTGTAAAATAGGGGG - Intergenic
980563392 4:134505968-134505990 ATGTGTTATTGGCTAATGGGTGG + Intergenic
988120349 5:26953199-26953221 ATCTGTATGTGTCAAATGGTTGG - Intronic
990487639 5:56275136-56275158 ATGTGTGAGTGCCCAATGGGTGG - Intergenic
991998343 5:72410851-72410873 ATGTGTATGAGGCACATGGCAGG - Intergenic
992507850 5:77405826-77405848 ATTTTTATTTGGCAAATGGGAGG + Intronic
993233267 5:85267824-85267846 ATGAGCAAATGGCAAAAGGGTGG - Intergenic
994558480 5:101334813-101334835 ATGTATAAGTGGCAATTGAATGG - Intergenic
994766847 5:103929176-103929198 ATGTGTATGTGGCAGAAAGGAGG + Intergenic
995005882 5:107194928-107194950 ATGTGTAAGTGCCCATTGGGTGG - Intergenic
995945522 5:117640413-117640435 ATGTGTAAATGGAAAATTGGTGG + Intergenic
1001778525 5:174347501-174347523 GTGTGTAGGTGGCAGATGGGAGG + Intergenic
1002406855 5:179041003-179041025 AGGTGTAAGTGGAAAATCAGGGG - Intergenic
1003282214 6:4703918-4703940 ATGTGTAAGTGCCCATTGGGTGG + Intergenic
1003739080 6:8914120-8914142 ATGTGTAAGTTGCATATGGCAGG - Intergenic
1004303332 6:14477929-14477951 ATGTTTAAGTGGCAATTAGAAGG + Intergenic
1006746046 6:36342728-36342750 ATGACTAAGTGGCAAGGGGGAGG + Intergenic
1007168445 6:39845515-39845537 ATGTGTAGGTAGCATATGTGTGG - Intronic
1007305565 6:40901380-40901402 ATGTGTAAGTACCAAATTGCAGG - Intergenic
1008593297 6:53015353-53015375 AAGTCTAAGTGGCCCATGGGAGG + Intronic
1010552841 6:77244201-77244223 ATGATTAAGTGTCAAATGAGAGG + Intergenic
1010717231 6:79243701-79243723 ATGTGTGAGTGGGAGGTGGGAGG + Intergenic
1013825637 6:114207675-114207697 AGGTGTAAAAGACAAATGGGTGG - Intronic
1015230804 6:130912808-130912830 GTGAGAAAGGGGCAAATGGGTGG + Intronic
1015464200 6:133529881-133529903 ATGTGTAAGTTGCATAGAGGAGG + Exonic
1015792917 6:136982020-136982042 ACGTCTAAGTGGCTAATGGATGG + Intergenic
1015948265 6:138524999-138525021 ATGTGTAAGTGGCAAATGGGCGG + Intronic
1017586884 6:155936320-155936342 ATGAGTAAGTGGCAGAAGGAAGG + Intergenic
1018974164 6:168551857-168551879 ATCTGCAAGTGGCAAGTGAGAGG - Intronic
1019079463 6:169420424-169420446 ATGGTGAAGTGGCAAATGGTAGG - Intergenic
1019335973 7:483024-483046 ATGGGTAAGTGATGAATGGGTGG + Intergenic
1022983201 7:35624366-35624388 ATGGGAAAGTGGCACAAGGGCGG + Intergenic
1023215193 7:37854809-37854831 TTGTGTATGTGGCAAAAAGGTGG - Intronic
1023314574 7:38921936-38921958 ATGTTTAAGTGGCATGTGGTTGG + Intronic
1025308723 7:57897582-57897604 ATCTGTAAGTGGAAATTTGGAGG + Intergenic
1026047551 7:66917662-66917684 GTGGGTAAGAGGCAATTGGGAGG - Intergenic
1028020847 7:85769043-85769065 ATGTGAAAGTGTGAAGTGGGAGG - Intergenic
1028491001 7:91411524-91411546 AGGTGCAGGTGGCAAATGGAGGG + Intergenic
1029796066 7:102895752-102895774 ATGAGAAAGTGCCAATTGGGAGG - Intronic
1030264130 7:107599924-107599946 ATGGGTAAGTGGGAAATGACAGG - Intronic
1030418338 7:109273562-109273584 ATGTCTATGTTGCAAATGGCAGG + Intergenic
1030713212 7:112778192-112778214 GTGTGTAAGCGTAAAATGGGAGG + Intronic
1030974203 7:116100909-116100931 ATGTGTAAAAGCCAGATGGGAGG + Intronic
1032934728 7:136715329-136715351 ATGTGTAAGTGCCCATAGGGTGG + Intergenic
1036194546 8:6702422-6702444 ATTTGTAATTGGAAAAAGGGAGG + Intergenic
1036243365 8:7096972-7096994 GTGTGTAAGTGGGAAATGGTGGG + Intergenic
1036257447 8:7217097-7217119 GTGAGTAAGTGGGAAATGGTAGG - Intergenic
1036309493 8:7675693-7675715 GTGAGTAAGTGGGAAATGGTAGG - Intergenic
1036360044 8:8070426-8070448 GTGAGTAAGTGGGAAATGGTAGG + Intergenic
1036890920 8:12596542-12596564 GTGCGTAAGTGGGAAATGGTAGG - Intergenic
1036898465 8:12654458-12654480 GTGCGTAAGTGGGAAATGGTGGG - Intergenic
1039868609 8:41527525-41527547 TTTTGTGAGTGGCAAATAGGTGG - Intergenic
1040670597 8:49685495-49685517 AAGTGTAAGGGGCATATGTGAGG + Intergenic
1041133788 8:54734110-54734132 ATAGGTAAGTGGCAAATTGAGGG - Intergenic
1042565472 8:70105846-70105868 TTGTGTTAGTGGGATATGGGAGG + Intergenic
1050190776 9:3023584-3023606 ATGCTTCAGGGGCAAATGGGAGG + Intergenic
1053143460 9:35696485-35696507 AGGTGTTAGTAGCAGATGGGTGG + Intergenic
1054424625 9:65048284-65048306 ATGTGTAAGTGGAATCTTGGAGG + Intergenic
1055196275 9:73598413-73598435 ATGTGTATGTGTCTATTGGGGGG - Intergenic
1055407229 9:75987642-75987664 ATGTTTAAGGGGAAAAAGGGAGG + Intronic
1055615945 9:78073160-78073182 ATGTGTTGATGGCAAATAGGTGG + Intergenic
1056500539 9:87204313-87204335 AAGTGTAAATGGCAAACGTGTGG + Intergenic
1057297507 9:93857988-93858010 ATGGGTAAGTGGATGATGGGTGG + Intergenic
1058605204 9:106714107-106714129 ATGTGTAATTGACAACAGGGAGG - Intergenic
1059135619 9:111803454-111803476 ATATGTAAGGGGGAAAGGGGTGG + Intergenic
1059521107 9:114943044-114943066 ATGCCTAAGAGGCAAATGGGGGG + Intergenic
1059634900 9:116160863-116160885 ATCTGTAAGTGGGAATTAGGAGG + Intronic
1060058469 9:120437121-120437143 ATGTGGAAGTGGTCACTGGGAGG + Intronic
1060145212 9:121246984-121247006 ACGTGTAGGTGGGAAGTGGGAGG + Intronic
1060423605 9:123486804-123486826 GAGTGTAAGAGGCAAATGTGTGG - Intronic
1060658417 9:125388470-125388492 ATGTGTGTTTGGCAAATGGACGG + Intergenic
1062352347 9:136145373-136145395 ATGTGTGAGTGGCCCATGGCTGG + Intergenic
1062437302 9:136551983-136552005 ATGTGTCTGGAGCAAATGGGGGG - Intergenic
1203392835 Un_KI270468v1:305-327 ATGTGTAAGTGGAAACTTGGAGG + Intergenic
1185638963 X:1575827-1575849 ATGGGTAAGTAGAAAGTGGGTGG + Intergenic
1187629995 X:21158671-21158693 AATTGTAAGTGGAAAATGGATGG + Intergenic
1188118333 X:26273894-26273916 ATCTGTAGGTGGCAGATGGTGGG - Intergenic
1189666380 X:43359104-43359126 ATGTGTATATGGTAAATGGTGGG + Intergenic
1189845006 X:45127875-45127897 TTGTTTAAGTGGCAAATGGTTGG + Intergenic
1191362297 X:59751464-59751486 ATGTGCAAGTGGCTATTGAGCGG + Intergenic
1191449784 X:60922299-60922321 ATGTGCAAGTGGCTATTGAGCGG + Intergenic
1193369654 X:80679077-80679099 TTGTGAAAGTGCCATATGGGTGG - Intronic
1194864909 X:99053877-99053899 ATGTGTAAGTGGCCAAGGCTTGG - Intergenic
1198023735 X:132684466-132684488 AAGCTAAAGTGGCAAATGGGCGG + Intronic