ID: 1015952876

View in Genome Browser
Species Human (GRCh38)
Location 6:138571784-138571806
Sequence AAGAGGCTGTTTCGCAGTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015952876_1015952879 -6 Left 1015952876 6:138571784-138571806 CCATCACTGCGAAACAGCCTCTT 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1015952879 6:138571801-138571823 CCTCTTTGTCTGCCTGGACAAGG 0: 1
1: 0
2: 1
3: 19
4: 185
1015952876_1015952880 -3 Left 1015952876 6:138571784-138571806 CCATCACTGCGAAACAGCCTCTT 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1015952880 6:138571804-138571826 CTTTGTCTGCCTGGACAAGGAGG 0: 1
1: 0
2: 2
3: 23
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015952876 Original CRISPR AAGAGGCTGTTTCGCAGTGA TGG (reversed) Exonic
900307943 1:2019970-2019992 AGGAGGCTGTCTCGCTGTGGAGG + Intronic
904190027 1:28736575-28736597 AAAAGCCGGTTTCTCAGTGAGGG - Intergenic
907873832 1:58466650-58466672 AGGAGGGTGTTTGGCAGGGAAGG - Intronic
908798311 1:67853274-67853296 AAGAGAGTGTTTCACAGAGAGGG + Intergenic
911694213 1:100870280-100870302 AAGCTGCTGTTTATCAGTGATGG + Intergenic
918312739 1:183297127-183297149 AGGAGGCTGTTGGGCAGGGAAGG - Intronic
923820276 1:237431377-237431399 AAGAGGTTGTTTCTGAGTGATGG - Intronic
923997438 1:239511087-239511109 ATGAGGCTGCTCAGCAGTGAAGG - Intronic
924380800 1:243462403-243462425 AAGGGGCTGTGTGGCTGTGAAGG + Intronic
1062846851 10:714149-714171 ATGAGGCCGTTCCTCAGTGATGG + Intergenic
1063033885 10:2266386-2266408 AAGAGGCTGTAGGGCAGTGACGG + Intergenic
1063381198 10:5587386-5587408 AAGATGCTGTTTTGCAGTCAGGG - Intergenic
1070209946 10:74306639-74306661 ATGAGGCTGATACGGAGTGAGGG + Intronic
1073124032 10:101139025-101139047 AAGAGGCTTTTTCTCTGGGATGG + Intergenic
1074516875 10:114178648-114178670 ACGTGGCTTTTTCACAGTGAGGG + Intergenic
1078645276 11:13136324-13136346 GAGAGGCTTTTTAGCAGTGGGGG - Intergenic
1081152603 11:39650855-39650877 AAGAGGCTCTCTCACTGTGAGGG - Intergenic
1085407908 11:76274953-76274975 AAGAGTCTGTGTCTGAGTGATGG + Intergenic
1088534632 11:110847026-110847048 AAGAGGTGGTTTCCCAGTAATGG - Intergenic
1089984088 11:122796680-122796702 ATGAGGTAGTTTCTCAGTGAAGG - Intronic
1091813903 12:3421698-3421720 AAGTGCCTGTTTCCCAGAGATGG - Intronic
1094362546 12:29645337-29645359 AGGAGGATGTTTCTGAGTGAAGG - Intronic
1099113971 12:78600690-78600712 AGGAGGCCATTTCTCAGTGAAGG + Intergenic
1099805974 12:87519001-87519023 AAAAGCCTGTATTGCAGTGAAGG - Intergenic
1101042625 12:100772017-100772039 AAGAGTCAGTTTCCCACTGAAGG - Intronic
1101921072 12:108933489-108933511 AAGATGGTGTTTTGCAGTGTTGG - Intronic
1102023031 12:109697027-109697049 AAGAGGCTGTTTCAGAGCCAGGG + Intergenic
1102673160 12:114637233-114637255 AGGATGCTGTTTCTCAGGGAAGG + Intergenic
1104515671 12:129423910-129423932 ATGAGGCTGTTACGAACTGAAGG - Intronic
1107266151 13:38557606-38557628 AAGAAGCTGTTTCAAATTGATGG + Intergenic
1111610787 13:90603810-90603832 AAGAGGGTGTTTCCCAGCAAAGG - Intergenic
1116140153 14:40983020-40983042 AAGATGGTGTTCAGCAGTGAAGG - Intergenic
1119574575 14:75707710-75707732 AAGAAGCTGTTTGGGGGTGAAGG + Intronic
1121653296 14:95575894-95575916 AAGAGGCTATTTCTAAGGGAGGG - Intergenic
1140467819 16:75196424-75196446 AACAGGCTGCTGGGCAGTGAGGG - Intergenic
1155822055 18:30390777-30390799 AAGAGGGTGGTTCCCAGTAAAGG + Intergenic
1159030582 18:63226383-63226405 AAGAGGGTGGGTCCCAGTGAGGG - Intronic
1161586187 19:5107088-5107110 CAGAGGCTGTTCAGCACTGAGGG + Intronic
1162452712 19:10764493-10764515 ACGGGGCTGCTTCCCAGTGAGGG - Intronic
1162471844 19:10876788-10876810 AGGAGGCAGTTTCTCAGGGAGGG + Intronic
1163173380 19:15548449-15548471 AGGAGGCAGTGTCGCAGGGATGG + Intronic
1163766104 19:19164362-19164384 AATTGGCTGTTTTGCTGTGAAGG - Intronic
1167654755 19:50756260-50756282 AAGAGACTGTTGAGCAGAGAAGG - Intergenic
1167656434 19:50767339-50767361 AAGAGACTGTTGAGCAGAGAAGG - Intergenic
1168577862 19:57528019-57528041 AACAGACTGTTACGGAGTGATGG + Intronic
1168583467 19:57574637-57574659 AAGAGGCTGCTTGGCAGTAGTGG + Intronic
925705763 2:6683490-6683512 AAGAGGGTGGTCCCCAGTGAGGG - Intergenic
926872258 2:17434877-17434899 AAGAGGCTGTCTAACACTGAGGG + Intergenic
930067254 2:47337094-47337116 AAGAAACTGTTTGGCAGAGACGG - Intergenic
930572418 2:53103777-53103799 CAGAGGCTGATTTTCAGTGATGG - Intergenic
932329482 2:70889556-70889578 AAGTGGCTGGCGCGCAGTGAGGG + Intergenic
932958701 2:76386712-76386734 GAGAGGCTGTTTTGCAATGGTGG + Intergenic
935029747 2:99310681-99310703 AAGAGTCAGTTTCACAGAGATGG + Intronic
938150755 2:128880296-128880318 AAGAGGGTGGTTCCCAGTGAGGG - Intergenic
938698379 2:133854820-133854842 AACAGGCTGTTTAGGAGAGAGGG + Intergenic
940357906 2:152765726-152765748 TAGAGCCTCTTTCGCAATGAAGG + Intergenic
941815874 2:169795543-169795565 AAGAAGCTGTTTCGAAATGTAGG + Intronic
944150562 2:196553980-196554002 AAGAGGTTGTTTGCCAGGGAGGG + Intronic
945701794 2:213179626-213179648 ATGCGGCTGTTTGACAGTGAGGG - Intergenic
1172460982 20:35118536-35118558 AAGAGGCTTTTTAGCAGCAAGGG + Intronic
1173326352 20:42037230-42037252 ATGATGCTGTGTGGCAGTGAGGG + Intergenic
1175312114 20:58019353-58019375 AGGAGGCTGTGTCGGAGTGATGG - Intergenic
1182133797 22:27881200-27881222 AACAGTCTGTTTCACAGTAAAGG + Intronic
1182927124 22:34135551-34135573 AAGAGTCTGTACAGCAGTGACGG - Intergenic
950005403 3:9688069-9688091 AAGAGGCTCTTCTGCAGGGAAGG + Intronic
953017917 3:39096165-39096187 AAGAAGCTGACTAGCAGTGAGGG - Exonic
954863849 3:53712487-53712509 AAGAGGCTGTTACTCTGTGGTGG + Intronic
956067465 3:65412189-65412211 AGGAGGCAGTTCCGCAGTGGAGG - Intronic
957708266 3:83818486-83818508 AAGATGCTCTTTCACAGGGAAGG + Intergenic
960384781 3:117009771-117009793 AAGAGGCTGTTGCACATTAAGGG - Intronic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
974060673 4:57031958-57031980 AGGAAGCTTTTTGGCAGTGAAGG + Intronic
974283402 4:59830304-59830326 AAGAGGCATTTTGGCCGTGAGGG - Intergenic
976911321 4:90309848-90309870 AAGAGGCTGCTTCTTAGTTATGG - Intronic
984017851 4:174446920-174446942 CAGAGGGTGTTTAGCTGTGAAGG + Intergenic
984405602 4:179325592-179325614 AAGAGGCTGTTGTGCTGTGACGG + Intergenic
986172713 5:5326963-5326985 GAGAGGCTGTTGTGCAGGGAAGG - Intergenic
986360936 5:6977579-6977601 AAAAGGCTGTGTCTCAGTGTGGG + Intergenic
987077440 5:14397355-14397377 GAGAGGCTGTTTTCCAGTGAAGG - Intronic
989394302 5:40936942-40936964 AAGAACCTGTTTCCAAGTGAAGG + Intronic
990128354 5:52548015-52548037 AAGAGGGTGGCTCCCAGTGAGGG + Intergenic
991966810 5:72100313-72100335 AAGAGGCACTTTCGGAGTCAAGG + Intergenic
993113345 5:83686990-83687012 AACTGGCTGTTTGGAAGTGAAGG + Intronic
998476843 5:142429131-142429153 CAGAGGGTGTGACGCAGTGATGG + Intergenic
1001667502 5:173445476-173445498 AAGAGGCTGTCCCACTGTGAAGG + Intergenic
1001677107 5:173528171-173528193 AAGAGGCTGTTCCGTAGGGCAGG - Intergenic
1001723845 5:173879816-173879838 AAGAAGCTGTTTAACATTGAGGG + Intergenic
1005124787 6:22434349-22434371 AAGAGGCTGTTACTCAGGGCAGG - Intergenic
1007364502 6:41381860-41381882 CAGAGCTTGTTTCCCAGTGAGGG + Intergenic
1010332738 6:74643536-74643558 AAGAGGCTGTTGCACAGTCCAGG + Intergenic
1011707031 6:90011732-90011754 AAGACGCAGTTTCGCTGTGTTGG - Intronic
1014244608 6:119054403-119054425 AAGGGCCTGTTCCGTAGTGATGG + Intronic
1015952876 6:138571784-138571806 AAGAGGCTGTTTCGCAGTGATGG - Exonic
1016147913 6:140699035-140699057 AAGGGGCTGTTGGGGAGTGAGGG - Intergenic
1017268325 6:152477431-152477453 AAGAGGATGTTTCAGACTGAGGG + Intronic
1018081323 6:160261647-160261669 AATAGGTTGTCTCACAGTGACGG + Intronic
1021654798 7:22864430-22864452 AAGAAGCTGAGTCACAGTGAGGG + Intergenic
1029777028 7:102689838-102689860 GGGAGGCTGTGTCGCAGCGAGGG - Intergenic
1030214097 7:107025738-107025760 AAGAGGCTGTCTTGCAGAGCTGG - Intergenic
1032019107 7:128396741-128396763 AAGAGGCTGTTGGGCAGGCAGGG - Intronic
1035053405 7:156017725-156017747 CAGAGGCTGTTTGGAAGAGAGGG - Intergenic
1035109794 7:156471545-156471567 AAGAGGCTTTTTCTCAGCAAAGG - Intergenic
1036388053 8:8298782-8298804 ATGTGTCTCTTTCGCAGTGAAGG - Intergenic
1037492423 8:19408794-19408816 TGGAGGCTGTTTATCAGTGATGG - Intronic
1037707445 8:21327012-21327034 GAGAGGCTGCTTAGCAGTGTAGG + Intergenic
1045455484 8:102374856-102374878 AAGAGTTTGTTTGGCAGTGAGGG - Intronic
1045511919 8:102818285-102818307 CAGAGGCTAGTTCCCAGTGATGG - Intergenic
1046496808 8:115024789-115024811 AACTGGCTATTTCCCAGTGAAGG + Intergenic
1048376776 8:133829392-133829414 AAGAGGCAGTTTTGCAGAGCTGG + Intergenic
1051394119 9:16600934-16600956 AAGAGGCACTTTCACATTGAAGG - Intronic
1051564686 9:18484088-18484110 AAGATGCTATTTTGCACTGAGGG - Intronic
1052342407 9:27377034-27377056 CTGAGGCTGTTTCACTGTGAAGG + Intronic
1057360266 9:94366926-94366948 AAGAGGCTATTTCAGACTGAGGG + Intergenic
1057663073 9:97021151-97021173 AAGAGGCTATTTCAGACTGAGGG - Intergenic
1058800063 9:108537098-108537120 AAGAGGCTATTTCACACAGAAGG + Intergenic
1062568933 9:137175630-137175652 GAGGGGCTGTTCCCCAGTGAGGG - Intronic
1185774625 X:2792694-2792716 AAGAGGCTGTTTCCTAGGGCTGG - Intronic
1186612551 X:11152475-11152497 AAGAGGCTGGCCAGCAGTGAAGG - Intronic
1201260488 Y:12154345-12154367 AATAGGCTCTTTCGGAGTAAGGG - Intergenic
1201711711 Y:16999924-16999946 AAGAGATTCTTTCCCAGTGAAGG - Intergenic