ID: 1015953479

View in Genome Browser
Species Human (GRCh38)
Location 6:138576861-138576883
Sequence TACCCATCACTGCTGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015953477_1015953479 -5 Left 1015953477 6:138576843-138576865 CCACATTTGAGGGTCACTTACCC 0: 1
1: 0
2: 0
3: 13
4: 69
Right 1015953479 6:138576861-138576883 TACCCATCACTGCTGACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015953479 Original CRISPR TACCCATCACTGCTGACAAA GGG Intronic
No off target data available for this crispr