ID: 1015961142

View in Genome Browser
Species Human (GRCh38)
Location 6:138650383-138650405
Sequence CCTGCTAGTCGGCGACCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 38}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015961142_1015961150 28 Left 1015961142 6:138650383-138650405 CCATGAGGTCGCCGACTAGCAGG 0: 1
1: 1
2: 0
3: 4
4: 38
Right 1015961150 6:138650434-138650456 TCCCTGTCAAGCATTTGGTGTGG 0: 1
1: 0
2: 0
3: 17
4: 213
1015961142_1015961149 23 Left 1015961142 6:138650383-138650405 CCATGAGGTCGCCGACTAGCAGG 0: 1
1: 1
2: 0
3: 4
4: 38
Right 1015961149 6:138650429-138650451 TGCAATCCCTGTCAAGCATTTGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015961142 Original CRISPR CCTGCTAGTCGGCGACCTCA TGG (reversed) Intronic
900566515 1:3334880-3334902 GATCCTAGTTGGCGACCTCAGGG - Intronic
901595089 1:10378576-10378598 CCTGAGAGTCAGCAACCTCAAGG - Intronic
906827813 1:49000387-49000409 CCTGCTAGTCTGAGAGCTCTGGG + Intronic
1079224779 11:18595790-18595812 CCTGCCAGTTGGCAGCCTCATGG - Intergenic
1099635554 12:85206685-85206707 CCTGATTGTCGGAGACCTCCAGG - Intronic
1106179997 13:27362268-27362290 CCTGCTACTCAACGACCTGAAGG + Intergenic
1114743253 14:25119593-25119615 CCTGCCAGGTGGCAACCTCAAGG + Intergenic
1121263393 14:92582796-92582818 CATGCTAGTGGCTGACCTCAGGG - Intronic
1122065917 14:99174540-99174562 CCTGCTGGACGGCGGCCTCTCGG - Exonic
1132620827 16:867663-867685 CCTCCTAGCTGGCGCCCTCAGGG - Intronic
1151911855 17:77088735-77088757 ACTGCGAGTCGGCGACCACCAGG - Exonic
1160232838 18:77061251-77061273 CATGGTAGTCAACGACCTCAAGG - Intronic
1162211212 19:9093670-9093692 CCTGCTGGTCGGCGCCCTCTGGG + Exonic
1162947334 19:14051987-14052009 CCGGCTAGTCGGAGCCCTCTGGG + Intronic
1168691608 19:58380884-58380906 CCTGCGAGGCGGGGACCTCCCGG - Intronic
940729766 2:157375479-157375501 CCTGCTAGGCGGTGCCCTCATGG + Intergenic
948995329 2:241575429-241575451 CCTGCTAGTCAGCAGCCTCAGGG - Intergenic
1169642194 20:7765405-7765427 CCTGCTTGTGGGAGTCCTCAAGG - Intergenic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1175958007 20:62621258-62621280 CCTGCCAGGCTGCGACCCCAGGG - Intergenic
1176243047 20:64083874-64083896 CCGGCTCCTCGGCGTCCTCAAGG - Exonic
1177727382 21:24987158-24987180 CTGGCTAGTCGGCAACATCACGG - Intergenic
1179991556 21:44950799-44950821 CCTCCTTGCCGGCGTCCTCAGGG + Intronic
1181467271 22:23116960-23116982 CCTGCTGGTCTGAGAGCTCATGG - Intronic
1184118868 22:42437739-42437761 CTTGCTAGGCGGTGGCCTCAGGG - Intergenic
950559544 3:13713796-13713818 CTTTCTACTCGGCCACCTCAAGG - Intergenic
968521950 4:1038064-1038086 CCTGTTAGTCGGCGGCCACCAGG - Intergenic
973801657 4:54484378-54484400 CCTGCTTGCAGGAGACCTCATGG - Intergenic
974673656 4:65063122-65063144 CCTGCTAATCTGAGACCTAAAGG - Intergenic
978367315 4:107995904-107995926 CCTGCTGGTCGTCTACATCAGGG + Intronic
1006831407 6:36970422-36970444 CCTGCTAGTTGGCGACCTCATGG - Exonic
1015961142 6:138650383-138650405 CCTGCTAGTCGGCGACCTCATGG - Intronic
1016427406 6:143949206-143949228 CCTGCTGGTAGGCCACCTCCAGG + Intronic
1018208637 6:161459256-161459278 CCTGCCAGTCTGCAACCTAAAGG + Intronic
1019270418 7:143990-144012 CCTGCAAGTCGGAGGCCTGAGGG + Intergenic
1022797356 7:33742696-33742718 CCTGCGAATGGGCGTCCTCAGGG + Intergenic
1024281800 7:47724728-47724750 CCTGCAAGTCCCCGACCCCAGGG + Intronic
1031434448 7:121715048-121715070 CCTGCTATTCGTAGAGCTCAAGG + Intergenic
1040436008 8:47392236-47392258 CCTACTAGTGGGCTACCTTAGGG - Intronic
1044129106 8:88498143-88498165 CCTCATAGTCGGAGACTTCAAGG - Intergenic
1061700252 9:132410249-132410271 CCGGCTCCCCGGCGACCTCAAGG + Exonic
1062645022 9:137543493-137543515 CCTGCTGGAGGCCGACCTCACGG - Exonic
1190999115 X:55641102-55641124 CCTGCTGGTCTCCTACCTCACGG + Intergenic
1196911747 X:120490683-120490705 CCTGCTAACTGGCGACCTGATGG - Intergenic