ID: 1015962153 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:138660967-138660989 |
Sequence | CTGTAGTCCCAGTTGGGACT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1015962144_1015962153 | 27 | Left | 1015962144 | 6:138660917-138660939 | CCTGGTCTCTACTAAAACTACAA | 0: 27 1: 4116 2: 174165 3: 210952 4: 122978 |
||
Right | 1015962153 | 6:138660967-138660989 | CTGTAGTCCCAGTTGGGACTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1015962153 | Original CRISPR | CTGTAGTCCCAGTTGGGACT GGG | Intronic | ||
No off target data available for this crispr |