ID: 1015962153

View in Genome Browser
Species Human (GRCh38)
Location 6:138660967-138660989
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015962144_1015962153 27 Left 1015962144 6:138660917-138660939 CCTGGTCTCTACTAAAACTACAA 0: 27
1: 4116
2: 174165
3: 210952
4: 122978
Right 1015962153 6:138660967-138660989 CTGTAGTCCCAGTTGGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr