ID: 1015966874

View in Genome Browser
Species Human (GRCh38)
Location 6:138703069-138703091
Sequence AATGAAATGCAGACTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015966871_1015966874 2 Left 1015966871 6:138703044-138703066 CCAAAGAGAGAAAATAGCTATAG No data
Right 1015966874 6:138703069-138703091 AATGAAATGCAGACTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015966874 Original CRISPR AATGAAATGCAGACTGGGCA TGG Intergenic
No off target data available for this crispr