ID: 1015968743

View in Genome Browser
Species Human (GRCh38)
Location 6:138722101-138722123
Sequence AAATACCCACAGATGGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015968743_1015968749 22 Left 1015968743 6:138722101-138722123 CCAATATCCATCTGTGGGTATTT No data
Right 1015968749 6:138722146-138722168 GATCAAAGTTCTCATGCCCCTGG No data
1015968743_1015968750 23 Left 1015968743 6:138722101-138722123 CCAATATCCATCTGTGGGTATTT No data
Right 1015968750 6:138722147-138722169 ATCAAAGTTCTCATGCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015968743 Original CRISPR AAATACCCACAGATGGATAT TGG (reversed) Intergenic
No off target data available for this crispr