ID: 1015969721

View in Genome Browser
Species Human (GRCh38)
Location 6:138731533-138731555
Sequence TGCTTAAACCCGGCAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015969710_1015969721 18 Left 1015969710 6:138731492-138731514 CCCGTAAATCCCAGCTACTCTGG 0: 9
1: 161
2: 522
3: 968
4: 3126
Right 1015969721 6:138731533-138731555 TGCTTAAACCCGGCAGGCGGAGG No data
1015969714_1015969721 9 Left 1015969714 6:138731501-138731523 CCCAGCTACTCTGGAGGCTGAGG 0: 8830
1: 210664
2: 276078
3: 178229
4: 93444
Right 1015969721 6:138731533-138731555 TGCTTAAACCCGGCAGGCGGAGG No data
1015969712_1015969721 17 Left 1015969712 6:138731493-138731515 CCGTAAATCCCAGCTACTCTGGA No data
Right 1015969721 6:138731533-138731555 TGCTTAAACCCGGCAGGCGGAGG No data
1015969716_1015969721 8 Left 1015969716 6:138731502-138731524 CCAGCTACTCTGGAGGCTGAGGT 0: 1338
1: 29188
2: 237486
3: 277431
4: 165822
Right 1015969721 6:138731533-138731555 TGCTTAAACCCGGCAGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015969721 Original CRISPR TGCTTAAACCCGGCAGGCGG AGG Intergenic
No off target data available for this crispr