ID: 1015974575

View in Genome Browser
Species Human (GRCh38)
Location 6:138776208-138776230
Sequence AACCCTGTGCTTTTACTCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015974575_1015974577 26 Left 1015974575 6:138776208-138776230 CCAGTGAGTAAAAGCACAGGGTT 0: 1
1: 0
2: 2
3: 17
4: 153
Right 1015974577 6:138776257-138776279 CACAGCGACCAAAGTTAAAAAGG 0: 1
1: 0
2: 1
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015974575 Original CRISPR AACCCTGTGCTTTTACTCAC TGG (reversed) Exonic
904149831 1:28428972-28428994 AACCCTGTGCTTTTTTCCATTGG + Intronic
904362216 1:29983625-29983647 AACCCTGTGCTTTCCCTCTGTGG - Intergenic
905683540 1:39892039-39892061 AACCCTCTACTTTTCCTTACTGG - Intergenic
907656948 1:56353225-56353247 TACCCTGGTCTTTTACTCTCTGG + Intergenic
907996863 1:59641865-59641887 AACCTTGTGCTTTTATGCAAGGG - Intronic
911688647 1:100806266-100806288 AACACTGTGCTTTAACCAACAGG + Intergenic
911928523 1:103869322-103869344 AAACCTGTGTTTTTATTCACTGG + Intergenic
914710258 1:150206688-150206710 ATGCCTCTCCTTTTACTCACTGG + Intergenic
916435899 1:164777510-164777532 AACTCTGAGCATTTTCTCACAGG + Intronic
916913649 1:169382317-169382339 AACACTGTCCTTTTACTGAAAGG + Intronic
917155303 1:171991341-171991363 TACCCTGTGCTCTGACTGACTGG + Intronic
918314435 1:183311229-183311251 AATCCTGTGCTCTTAATGACTGG - Intronic
918428470 1:184434632-184434654 AACCCAGTGCTGCCACTCACAGG - Intronic
921086131 1:211794773-211794795 CATCCTGAGCTTTTACACACAGG - Intronic
921986243 1:221316010-221316032 AACCCTGTCCTCTTAATCATGGG - Intergenic
923158136 1:231296257-231296279 AACCATGTACCTTTACTCAGCGG + Intergenic
1063773452 10:9231220-9231242 AACCATGTTCTTTTACTCATTGG - Intergenic
1067272306 10:44803069-44803091 CACCCTGTGCTTCTGCCCACTGG + Intergenic
1067558744 10:47289756-47289778 AAACCTGTGCTGTCACACACTGG - Intergenic
1070271265 10:74957699-74957721 AACCCGGTCCTCTTACTAACGGG - Intronic
1070740195 10:78898289-78898311 ATCCCTGTTGTTTTACTCTCAGG - Intergenic
1074921099 10:118013409-118013431 AACACTGTGCTTTCACAGACAGG + Intronic
1076947561 10:133661825-133661847 AACGCTGTTCTTTAACTCACGGG + Intergenic
1078256332 11:9662419-9662441 AACCATGTGGTTTTGCTGACTGG + Intergenic
1078296102 11:10071751-10071773 AATCATGTGGTTTTTCTCACTGG + Intronic
1079315633 11:19405834-19405856 GACCCAGTGCTTTTACTCAAAGG - Intronic
1083189560 11:61040132-61040154 AGCCCTGAGCTTTTCCACACAGG - Intergenic
1084767207 11:71320388-71320410 AGCCCTGCACTTTTACCCACTGG + Intergenic
1085154699 11:74282829-74282851 AACTCTAAGCTTTTTCTCACTGG - Intronic
1086840597 11:91679121-91679143 AAGCCTATGCTTTCACTCACCGG - Intergenic
1092261292 12:6954572-6954594 GACGCTGAGCTGTTACTCACTGG - Intronic
1093410666 12:18862125-18862147 AACCCTCAGTTTTTACTCATAGG + Intergenic
1093828691 12:23728059-23728081 AGCCCTGTCCTTTCACTCAGAGG - Intronic
1095189507 12:39240416-39240438 AACCCTGTGATTTTTCCCATGGG + Intergenic
1096598808 12:52714893-52714915 AACTCTCTGGTTTTCCTCACAGG - Intergenic
1097303716 12:58046024-58046046 AACCCGGTTCTGTCACTCACTGG - Intergenic
1097372405 12:58800353-58800375 AACCATGTGGTTTTTGTCACAGG + Exonic
1098322482 12:69260022-69260044 AACCCTTTCCTTTCCCTCACAGG + Exonic
1098579539 12:72083019-72083041 GACTCAGTGGTTTTACTCACTGG - Intronic
1099962496 12:89410191-89410213 AACCATGTGGTTTTTGTCACTGG - Intergenic
1101511849 12:105400355-105400377 ATCCCAGTTCTTTTACTTACTGG + Intergenic
1103787695 12:123445664-123445686 AACACTCTGCTATCACTCACTGG - Intergenic
1109734235 13:66460551-66460573 AATCCTGAGCCTTTTCTCACAGG + Intronic
1111019874 13:82435743-82435765 AACCCTGTGCTTTTGCAATCAGG - Intergenic
1112323067 13:98424550-98424572 AACCCTTTGCTTTTGCTCTCAGG + Exonic
1112970961 13:105261669-105261691 AGCCCTGTGGATTTACTCATGGG + Intergenic
1116434583 14:44882206-44882228 AATCCAGGGCTTTTATTCACTGG - Intergenic
1118680160 14:68232794-68232816 AGCTCTGAGCTTTTACTCACAGG + Intronic
1119151707 14:72366322-72366344 AACTCAGTGCATTTACTCCCTGG - Intronic
1121921598 14:97887240-97887262 CACCCAGTGCTTTTCCCCACTGG - Intergenic
1123975425 15:25549035-25549057 AAACCTGGGCATTTACCCACTGG + Intergenic
1128625143 15:69193709-69193731 AATCCTGTGCTTGTACTACCTGG + Intronic
1128674247 15:69597007-69597029 ACCCCTGTTCTTTCACTTACTGG + Intergenic
1131909394 15:97180273-97180295 TACACTGTGCTGTTACTCTCAGG + Intergenic
1133421734 16:5652388-5652410 AAGCCTGTGCTTTTAACCACTGG + Intergenic
1134152744 16:11817922-11817944 AACCCTGTGCTCTTAGGCACTGG + Intergenic
1141214872 16:82013943-82013965 AAGCCTTGGCTTTTAATCACAGG - Intergenic
1142759965 17:2036407-2036429 TACCCTGTCCTTTTACCCCCAGG + Intronic
1144313076 17:14032007-14032029 ATCCTTGTGCATTTACTCTCTGG - Intergenic
1147653223 17:42073612-42073634 GACCCTGTGCTTTGATTCCCTGG - Intergenic
1147945149 17:44076585-44076607 AACCCTGTCTTTTCACTTACAGG + Intergenic
1149000649 17:51753802-51753824 AAGCCTGTGCTTTTAACCACTGG + Intronic
1150914097 17:69418786-69418808 AAGCCTGTGGTTTTGCTCCCTGG - Intronic
1152978861 18:253249-253271 AACCCAGTAATTTTACTTACTGG + Intronic
1156549829 18:38003960-38003982 AACCCTCTGCCTTTTCTCAAGGG - Intergenic
1157894052 18:51447498-51447520 ACCCCCCTGTTTTTACTCACAGG - Intergenic
1159415311 18:68139451-68139473 AATCATGTGGTTTTCCTCACTGG + Intergenic
1159569267 18:70093557-70093579 AATCATGTGGTTTTTCTCACTGG + Intronic
1160072338 18:75639910-75639932 TACCCTGGGCTTGTACTCGCAGG - Intergenic
1161613837 19:5258602-5258624 ACCCATGTTCATTTACTCACGGG - Intronic
1165995156 19:39838885-39838907 AAGCCACTCCTTTTACTCACAGG + Intronic
1166263551 19:41660982-41661004 AATCATGTGTTTTTTCTCACTGG - Intronic
925262551 2:2541151-2541173 AGCCCTGTACTTTCACCCACTGG - Intergenic
925545424 2:5010683-5010705 AACCATATGCTTTTACCTACAGG + Intergenic
925591435 2:5513769-5513791 AACCTTGTCCACTTACTCACAGG - Intergenic
925649388 2:6073240-6073262 AACCCTGTGCTTTTCTTAATAGG + Intergenic
927562071 2:24081031-24081053 AACCCTGTACTTTCTGTCACAGG - Exonic
928136497 2:28691952-28691974 CAGCCTGTGCTTATACTCAGAGG - Intergenic
928256518 2:29727636-29727658 ATCCTTGTGCTTTTACTAAGGGG + Intronic
929569502 2:43012114-43012136 AACTCTGTGCTTTCACTCCTAGG - Intergenic
929880406 2:45832047-45832069 AAAACTGTTCTTTTTCTCACAGG + Intronic
932486097 2:72085251-72085273 AACCATGTTCTTGTACTCCCCGG + Intergenic
934511626 2:94948760-94948782 AGCCCTGTGCTTCTCATCACCGG + Intergenic
935384176 2:102484104-102484126 AACCCTTTGCTTTTACTAAGAGG + Intronic
937464677 2:122121495-122121517 AACCATGTGGTTTTTGTCACTGG + Intergenic
939772420 2:146337681-146337703 AGCCCTGTTCTTTCACTTACTGG - Intergenic
943662257 2:190571678-190571700 AACCCTGTGGTTTGACTCTAGGG - Intergenic
945338503 2:208620632-208620654 GCCCATGTGCTTTTAGTCACTGG - Intronic
946126423 2:217566962-217566984 GAACCTGTGCCTTTACTCAAAGG + Intronic
946422607 2:219572990-219573012 AACCCTGTTTCTTTACTCCCAGG + Intronic
946625770 2:221610914-221610936 AAACCTCTGCTCTCACTCACGGG - Intergenic
946662606 2:222017551-222017573 AACACTGGGCTGTTAATCACCGG + Intergenic
948297349 2:236871680-236871702 AACCCTGCGCACATACTCACTGG - Intergenic
1172613749 20:36269774-36269796 AACCATGTACTGTTTCTCACAGG - Intronic
1173790898 20:45827208-45827230 GACTTTGTGCCTTTACTCACGGG - Intronic
1176680344 21:9815981-9816003 AACCCTGGGCTTTTACAAGCGGG - Intergenic
1177033180 21:16008708-16008730 AAGCATGTACTTTTACCCACAGG - Intergenic
1181365137 22:22370746-22370768 TACCTTGTGCTTTTTCTCTCTGG + Intergenic
1182320991 22:29478617-29478639 AACCCTCTGCTTTTACTTTAGGG - Intergenic
1182672149 22:32005395-32005417 AACCCTCTTCTGTTACTCATGGG - Intergenic
1182767507 22:32768975-32768997 AACCCTGTGCTCCTACTCCATGG + Intronic
956207052 3:66765914-66765936 AACCATGTGGTTTTTGTCACTGG + Intergenic
957395330 3:79628775-79628797 AACCCTTTGCTTTTAGTCTGTGG - Intronic
957466156 3:80595202-80595224 AACACTGAGCTTTTAATCAGTGG + Intergenic
959084354 3:101835256-101835278 AACCCCATGCTTTTAATCAAGGG + Intronic
960726841 3:120678753-120678775 AACTCTGTACTTTTTCTCTCAGG - Intronic
960987979 3:123292734-123292756 ATCCCTGTGCTTCTTCTCACAGG + Intronic
961871680 3:129993068-129993090 TAAACTGTCCTTTTACTCACTGG + Intergenic
962177544 3:133169843-133169865 ATCACTGTGTTTTTACTCATTGG - Intronic
962664738 3:137642610-137642632 AAACCTGTGCTTTTATTTAGGGG + Intergenic
962748097 3:138412445-138412467 AAGCCTGTGTTTTAACTCCCAGG - Intergenic
963533147 3:146496809-146496831 AAACCTGTGCCCTTATTCACAGG - Intergenic
964185688 3:153940015-153940037 AGTCCTGAGCTTTTTCTCACTGG - Intergenic
967110676 3:186290793-186290815 AACTCTCTGCTGTTACTCAAAGG - Intronic
970514180 4:16811129-16811151 AAACCTGTGCTGTAACTCAGGGG - Intronic
972335114 4:38100963-38100985 ATCCCTGGGCTGTCACTCACCGG + Intronic
973532366 4:51845183-51845205 AACCCAGTGCTTACACACACTGG - Intronic
973945593 4:55951257-55951279 AACCCTGTGATTTTATTCCCAGG - Intronic
974016224 4:56651727-56651749 AACCCAGTGGTTTTAGTCACTGG - Intronic
975141845 4:70926647-70926669 AACACTTCGCTTTTACACACAGG - Intronic
976339612 4:83932459-83932481 ATCCCTGTGGTTTCTCTCACTGG + Intergenic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
978544364 4:109854826-109854848 AATCATGTGCTTTTTGTCACTGG + Intronic
980677245 4:136102320-136102342 AACTCTGTGCTTTTATTTCCAGG + Intergenic
985451017 4:190062622-190062644 AACGCTGTTCTTTAACTCACGGG + Intergenic
986652775 5:9980696-9980718 AACTTTGTGCTTCTACTCACAGG - Intergenic
987327639 5:16826920-16826942 GACCCTGTGCTTTCAATGACTGG + Intronic
990622780 5:57578498-57578520 AACCCTGTCCTTTTGAACACAGG - Intergenic
996681526 5:126232532-126232554 AACCCAGTGGTTTTACTCACTGG - Intergenic
997234467 5:132264828-132264850 TACCCTGTGCTCTCACTCCCAGG + Intronic
999707895 5:154290760-154290782 AACCATGTCCTTTGACTCCCAGG - Intronic
999732490 5:154485007-154485029 AACCCTTTCCTTCTGCTCACAGG + Intergenic
1000896693 5:166863530-166863552 GAACCTGTGCTTTTAGTGACTGG + Intergenic
1001010451 5:168093085-168093107 GAGCCTGTGCTTTTAACCACTGG + Intronic
1001445218 5:171777601-171777623 AACACTGAGCTTCTACTCAGTGG + Intergenic
1002364062 5:178696567-178696589 AACCCAGTGGTTTTAGACACTGG + Intergenic
1003635274 6:7826225-7826247 CTCCCTGTTCTCTTACTCACAGG + Intronic
1004442322 6:15665328-15665350 AACCCAGTGCTTTTTGTGACTGG + Intergenic
1011621107 6:89243325-89243347 AAACCTGTGCTTTTGATCCCGGG + Intergenic
1013317849 6:108958910-108958932 AACCCTGTGCTTCCACTCACTGG - Intronic
1013436032 6:110108372-110108394 AAACCTTTGCTTTTATTCATTGG - Intronic
1015974575 6:138776208-138776230 AACCCTGTGCTTTTACTCACTGG - Exonic
1025264273 7:57442317-57442339 AGCCTTGTGCCTTCACTCACAGG + Intergenic
1026576422 7:71575337-71575359 AACCCTATGCTTTCATTCAATGG + Intronic
1026873579 7:73867492-73867514 GACCCTGTGTCCTTACTCACAGG - Intergenic
1030015036 7:105210741-105210763 AACCCTCTGCTTTTAGGGACTGG - Intronic
1031346096 7:120669356-120669378 AACCCTGTGATTTTTTTAACTGG + Intronic
1033885955 7:145945582-145945604 GACCCTGGACTTTTATTCACTGG - Intergenic
1035957441 8:4096963-4096985 ATCCCTTTGAATTTACTCACTGG - Intronic
1039531596 8:38268164-38268186 AACCCAGTGCATTTAGGCACAGG + Intronic
1039753975 8:40502918-40502940 AGCTCTGTGCTTTTACCCATAGG - Intergenic
1041628808 8:60061729-60061751 TACCCAGTGCTTGGACTCACTGG - Intergenic
1042886488 8:73558204-73558226 AACCCCGGGCATTTACTTACTGG - Intronic
1045604626 8:103758581-103758603 AGACCTGTGCTCTTATTCACTGG + Intronic
1047164944 8:122427382-122427404 AGTCCTGTGCTTTTACTACCTGG - Intergenic
1048996332 8:139795862-139795884 GACCCTGTGCATTCACGCACTGG - Intronic
1051179893 9:14400244-14400266 ATCCCTGTGCATTTACTGAGTGG - Intergenic
1052173124 9:25426281-25426303 AACTCAGTTCTTTAACTCACAGG + Intergenic
1052598359 9:30592519-30592541 AACCCTGATCTTATACTAACTGG - Intergenic
1056998616 9:91487335-91487357 AGCCCTTTGCTTCTCCTCACTGG - Intergenic
1058132138 9:101265168-101265190 AACACAGTGCTTTTAACCACAGG + Intronic
1059909107 9:119022699-119022721 AATCCTATGTATTTACTCACTGG + Intergenic
1061112305 9:128583055-128583077 AACCCCCTTCTTTTATTCACAGG + Exonic
1186114515 X:6291549-6291571 AACCATGTGGTCTTACTCCCCGG - Intergenic
1187081012 X:15987754-15987776 AACCCTCTGAATTTCCTCACTGG - Intergenic
1189299295 X:39941311-39941333 CACCCTGTGCTTTTCCCCCCAGG - Intergenic
1190746505 X:53326195-53326217 GACCCTGTTCCTTTCCTCACAGG - Intergenic
1191231065 X:58095450-58095472 GAACCTGTGCTTATATTCACCGG + Intergenic
1191239010 X:58164704-58164726 AAACCTGTGTTTTGACTCACTGG + Intergenic
1197610672 X:128634808-128634830 TTACCTTTGCTTTTACTCACTGG - Intergenic
1198516224 X:137410187-137410209 AAACATGTACTTTTAATCACCGG - Intergenic