ID: 1015974986

View in Genome Browser
Species Human (GRCh38)
Location 6:138780939-138780961
Sequence TTATGCATCTTCTAAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 298}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015974986 Original CRISPR TTATGCATCTTCTAAAAAAC TGG (reversed) Intronic
903415543 1:23180157-23180179 TGTTGCTTCTTCTGAAAAACAGG + Intergenic
904937046 1:34138593-34138615 CTATGCATCTTCTACATAAATGG + Intronic
905595566 1:39203868-39203890 TTATTCATAATATAAAAAACTGG - Intronic
906765896 1:48433019-48433041 TTATGTGTTTTTTAAAAAACTGG - Intronic
906923436 1:50089274-50089296 TAATGCAGATTCTTAAAAACTGG + Intronic
908478608 1:64513859-64513881 TTTTACATCTTATAAAAATCTGG - Intronic
908916761 1:69136660-69136682 TAATGCATTTTTTAAAAATCTGG + Intergenic
909762341 1:79306608-79306630 TTATGCAACTTATTAAAAAATGG - Intergenic
910058023 1:83055137-83055159 TTATGCACTTTTTAAAAAGCTGG - Intergenic
910415968 1:86999061-86999083 GTATACATTTTCTAAAACACAGG - Intronic
910763756 1:90760541-90760563 GTATGCATCATCTTAAAAATGGG - Intergenic
911436478 1:97865793-97865815 TTAGGCTTCTTTTAAAAACCTGG - Intronic
911582901 1:99655553-99655575 CTTTGCCTCTTCAAAAAAACTGG + Intronic
911618803 1:100043432-100043454 TTATTTATTTTTTAAAAAACAGG - Intronic
912103228 1:106237914-106237936 TTATACATATTCTACAAACCAGG + Intergenic
913399797 1:118418720-118418742 TTACACATCTCCTAGAAAACAGG - Intergenic
915782625 1:158569522-158569544 TAATGCACCTACCAAAAAACTGG + Intergenic
915926630 1:160026378-160026400 GCATGCATCTCCTAAAAATCAGG - Intergenic
916426391 1:164685149-164685171 TTAGACATCTCCTAAAAGACAGG - Intronic
917707896 1:177653284-177653306 TGCTGCATCTTTTTAAAAACTGG - Intergenic
918277133 1:182964127-182964149 TTCTGCATCTTTTAAAAAACTGG + Intergenic
920317537 1:205088933-205088955 TTATGTATTTTCTTAAAAAGGGG - Intronic
920778013 1:208959245-208959267 TTATGCATCCTCTGAAAACTAGG - Intergenic
921277493 1:213534257-213534279 TTTTGCATCTTTTAAAAGTCAGG - Intergenic
921374115 1:214455764-214455786 TTAAGCATATACTAAAAAATCGG + Intronic
921879056 1:220232863-220232885 TTGTTCATCTTTTTAAAAACAGG - Exonic
923370643 1:233308767-233308789 TTATGCAGCTTCTGAAAATTTGG - Intergenic
1063054263 10:2486095-2486117 GTATTAATGTTCTAAAAAACAGG + Intergenic
1063081669 10:2773208-2773230 ACATGAATCTTCTAAACAACAGG + Intergenic
1066312890 10:34214750-34214772 TTATGCTTCTCCTGAAAAAGAGG - Intronic
1066351059 10:34637188-34637210 TTATCCATCTTGCACAAAACTGG - Intronic
1067456679 10:46424111-46424133 TTATGCATATGCTAAGAAGCTGG - Intergenic
1067630522 10:47960528-47960550 TTATGCATATGCTAAGAAGCTGG + Intergenic
1068191794 10:53661524-53661546 TAATGCCTCTTCTAGAAAAATGG + Intergenic
1068319919 10:55399030-55399052 TTACTCATCTTGTGAAAAACAGG + Intronic
1068574385 10:58668088-58668110 CTATGCATTTTCTTAAAAGCCGG - Intronic
1069858863 10:71457740-71457762 GAATGCATCTTCTGAGAAACAGG - Intronic
1070484529 10:76916794-76916816 TTATGCACCTCCAAAACAACAGG - Intronic
1071907762 10:90193274-90193296 TTCAGCATCTTTTAAAAAAGGGG - Intergenic
1072453447 10:95557466-95557488 TTTTGCATTTACAAAAAAACCGG + Intronic
1072656203 10:97332269-97332291 TCTTGCAGCTTCTAAAAACCTGG + Intergenic
1072896972 10:99375820-99375842 TTCTGCTTCTTCCAAAAAAGGGG - Intronic
1073000344 10:100280124-100280146 GGATGCATATTCAAAAAAACTGG - Exonic
1073548988 10:104380017-104380039 TTAAGCATGTTCTAAAAATAAGG - Exonic
1075032924 10:119038439-119038461 TTTTGCTTTTTCAAAAAAACAGG - Exonic
1075535238 10:123265675-123265697 TTATCCTTCTTCTAAATAATGGG + Intergenic
1076425235 10:130362985-130363007 TAATGCAACTTCTAAGAACCGGG - Intergenic
1079608240 11:22397072-22397094 TTATGCCTCTTCTCATAGACTGG - Intergenic
1079699839 11:23531071-23531093 TTATTCATCCTTAAAAAAACAGG - Intergenic
1079808576 11:24964512-24964534 ATATGCATCTTTTAAAATCCTGG - Intronic
1080006678 11:27415435-27415457 GTGTGCATGTTTTAAAAAACTGG - Intronic
1080355906 11:31445556-31445578 TGATGCATTTTTTTAAAAACAGG + Intronic
1081176973 11:39940032-39940054 TTATGAAACTACTAAAAAAAAGG - Intergenic
1085084836 11:73660273-73660295 TTATGCGTCTTTTAAACAACAGG - Intronic
1086029839 11:82340963-82340985 TTAAGCATTTTTTTAAAAACGGG - Intergenic
1086746420 11:90433131-90433153 TTATGCATCTATTACAAAATGGG - Intergenic
1087249152 11:95876481-95876503 TGATGCATCTCATAGAAAACAGG - Intronic
1088029616 11:105230585-105230607 ACATGTATCTTCTATAAAACTGG + Intergenic
1089437177 11:118479376-118479398 TTAAGCATCTTGTAAACTACTGG + Intronic
1089552282 11:119289496-119289518 TTATGCAAATACTAAAAGACAGG - Intronic
1092923363 12:13252066-13252088 TTATGCATTTTCAAAACCACTGG + Intergenic
1093147797 12:15587754-15587776 TTATGCAACCTCAAAAGAACAGG + Intronic
1093904065 12:24668469-24668491 TTCTGCATTTTCTAAGAATCTGG - Intergenic
1093950001 12:25154288-25154310 TTATGCATTTTCCTATAAACTGG - Intronic
1094447537 12:30547369-30547391 TTATTTATGTTCTAGAAAACAGG - Intergenic
1094811244 12:34140265-34140287 TTATACATCTTTTAAAAAATGGG - Intergenic
1095541648 12:43315877-43315899 TTATGCCTTTTCTAAGAAAATGG - Intergenic
1095708767 12:45266287-45266309 TTATGAATATTTTTAAAAACTGG - Intronic
1098558709 12:71848650-71848672 TTATTCATCTTATATAAAAGGGG + Intronic
1098860954 12:75709388-75709410 TTATGCATCTTTTTAAAGGCAGG + Intergenic
1099849830 12:88079142-88079164 TTCTGCAACTTCTCAAAAAGAGG - Exonic
1100221230 12:92506488-92506510 TTCTACATCTTCAAACAAACAGG + Intergenic
1100884723 12:99057205-99057227 TTATGCTTATTCTAAAAAAGAGG - Intronic
1100992182 12:100263341-100263363 TTATGCATTTCCTCTAAAACTGG - Intronic
1101391171 12:104301849-104301871 TTATCCCTCTTCTAAAATAAAGG - Intronic
1101487312 12:105178118-105178140 TTAAGCATCATCTAATAATCAGG + Intronic
1101680745 12:106962278-106962300 GTATGCATTTTTTAAAAAATTGG + Intronic
1102771112 12:115477460-115477482 TTTTTCATCTTCTAAAAAATGGG + Intergenic
1103002286 12:117394369-117394391 TTTTTCCTCTTCAAAAAAACTGG + Intronic
1103756205 12:123209334-123209356 TTTTTCAACTTCTAAAATACTGG - Intronic
1105448038 13:20474495-20474517 TTATGCATCTTGTCAAATAGGGG - Intronic
1105625942 13:22112698-22112720 TTATTCATGTTGTAAAAAAATGG + Intergenic
1108481653 13:50878397-50878419 TTCTGCATCTTATAAAAGAGTGG + Intergenic
1109135949 13:58651187-58651209 TTATCCATCTTCCAAACAAAGGG + Intergenic
1109453623 13:62552686-62552708 TTTTGCATCTTCTAAGATCCTGG + Intergenic
1110106990 13:71689882-71689904 TTATGTATATTCTAAAAAAGGGG - Intronic
1110834569 13:80068651-80068673 ATATTCATCTTCTTAAAAAGGGG - Intergenic
1111030202 13:82587131-82587153 ATATGGATCTTCTAAACTACAGG + Intergenic
1111109654 13:83690217-83690239 TAATGGAGCTTCTAAAATACTGG - Intergenic
1112560702 13:100511215-100511237 TGATGCATCTTTAAAAACACTGG - Intronic
1112713920 13:102162088-102162110 CTTAGCATCTTTTAAAAAACAGG - Intronic
1115379296 14:32716578-32716600 TTATGTATTTTCTAAAAGACAGG - Intronic
1116586729 14:46715378-46715400 TTATTTATTTTTTAAAAAACAGG + Intergenic
1116723446 14:48530008-48530030 TTAAGGATTTTCTAAAAAATCGG + Intergenic
1117110093 14:52443758-52443780 TTAGTCATCTTTTGAAAAACAGG - Intronic
1118243128 14:64081139-64081161 TTATGCTTCATTTTAAAAACTGG - Intronic
1119280638 14:73404425-73404447 GCATGCATCTTCTAAGAAAAAGG - Intronic
1119530656 14:75358455-75358477 TTATGCTTCTCCTAAACACCTGG + Intergenic
1120488996 14:85152573-85152595 TAATTCATATTCTCAAAAACAGG - Intergenic
1120575331 14:86174606-86174628 CTATACATCTTCTAAAATCCAGG - Intergenic
1121209657 14:92198656-92198678 TTATAAAACTTCTAAATAACAGG + Intergenic
1121413964 14:93766128-93766150 ATGAGCATCTTCTGAAAAACTGG - Intronic
1123144925 14:106120151-106120173 TTTGGCATCTTTTAAAAAACTGG - Intergenic
1124356837 15:29001803-29001825 TTTTCCATCTTTTAAAAAAAAGG - Intronic
1125146023 15:36469420-36469442 TAATGTTTCTTCTAATAAACAGG - Intergenic
1125193387 15:37019308-37019330 TTATGCCTCTTCTACACAAGGGG - Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1127184410 15:56463467-56463489 TTATGCTTTTTCTATAAAATGGG - Intronic
1129970080 15:79770390-79770412 TTATGTGTCTTCTTATAAACAGG + Intergenic
1130793793 15:87187226-87187248 TTCTACATCTAATAAAAAACTGG + Intergenic
1135081793 16:19442742-19442764 TTATGAATTTGATAAAAAACTGG + Intronic
1135716080 16:24768779-24768801 TTGTAAATCTTCTAAAACACTGG - Intronic
1136694275 16:32062811-32062833 TTTGGCATCTTTTAAAAAACTGG + Intergenic
1136794772 16:33006075-33006097 TTTGGCATCTTTTAAAAAACTGG + Intergenic
1136875134 16:33848317-33848339 TTTGGCATCTTTTAAAAAACTGG - Intergenic
1141419969 16:83908134-83908156 CTGTGCATCCTGTAAAAAACTGG + Exonic
1203097035 16_KI270728v1_random:1267725-1267747 TTTGGCATCTTTTAAAAAACTGG + Intergenic
1144923813 17:18786015-18786037 TGATGCAGCTTCTAAACACCTGG + Intronic
1145038905 17:19561889-19561911 TTATGCAACTACTACAAACCGGG - Intronic
1145212146 17:21021788-21021810 AACTGCATCTTCTAAAAAATGGG + Intronic
1149051401 17:52309816-52309838 TTATACATCTTCTGAAATTCAGG + Intergenic
1149357154 17:55851831-55851853 TTTTACCTCTTTTAAAAAACTGG - Intergenic
1154236071 18:12607152-12607174 CAATGCATTTTCAAAAAAACAGG - Intronic
1155077792 18:22376625-22376647 CAATGAATCTTCTAGAAAACTGG + Intergenic
1155520879 18:26667863-26667885 TTATGCAAGTTTTAAAAAAATGG - Intergenic
1155643676 18:28051068-28051090 ATATGCATATTGTAAAAAATAGG + Intronic
1155870050 18:31016135-31016157 TCATGCATTTTCTGGAAAACTGG - Intronic
1156945446 18:42824512-42824534 TTATGCATCTTTGAGAAAAAAGG - Intronic
1159316302 18:66778130-66778152 CAATGCATTTTCTAAAAATCAGG - Intergenic
1167540416 19:50083139-50083161 TTCTGCCTTTTTTAAAAAACAGG + Intergenic
1167629290 19:50614656-50614678 TTCTGCCTTTTTTAAAAAACAGG - Intergenic
928878371 2:36067918-36067940 TTATGCCTCTTCAAAACATCTGG - Intergenic
929104632 2:38352224-38352246 TTTTGCATTTTTTAAAACACAGG + Intronic
929379057 2:41327779-41327801 TTATGAATTTTATTAAAAACTGG + Intergenic
930326131 2:49921119-49921141 TTTTGCATTTTCTATACAACAGG + Exonic
931056434 2:58477570-58477592 TTATTCATCTTCTAAGACAGTGG - Intergenic
931168924 2:59781625-59781647 TTATGTAACTCCTGAAAAACTGG - Intergenic
931423937 2:62153687-62153709 TTATACATCTTCTAAGAATAAGG - Intergenic
931603576 2:64029167-64029189 CTATACATTTTCTAAAATACTGG - Intergenic
932998541 2:76889705-76889727 TTAAGCATCTACTAAAAATTTGG - Intronic
933151548 2:78921484-78921506 TTAGTCATCTTCCAAAACACAGG + Intergenic
933733268 2:85474394-85474416 TTAGGCATCTCCTAAAAATCAGG - Intergenic
934117000 2:88808000-88808022 TTTTGCATGTTCTGATAAACTGG + Intergenic
935180668 2:100688206-100688228 TTTTGCTTCTTTTAAAAAAATGG + Intergenic
935378497 2:102424510-102424532 GTATACAGCTTCTCAAAAACTGG + Intronic
936761769 2:115794393-115794415 TTATGGATCTTCAAAAGAAATGG + Intronic
936824174 2:116560462-116560484 TCAAGTATCTTCTTAAAAACAGG - Intergenic
937771393 2:125724375-125724397 TTATGCAAGTTCTCAGAAACAGG - Intergenic
939717117 2:145598186-145598208 TTTTGCTTCTTCCAGAAAACTGG - Intergenic
939952776 2:148495016-148495038 TTATACTTGTTCTAAATAACTGG + Intronic
940642244 2:156357563-156357585 TTATGCATCATCAACAAAATTGG + Intergenic
941406690 2:165098721-165098743 TTATGCATTTACTTGAAAACAGG - Intronic
943742066 2:191420630-191420652 TCATGCATCATCTAATAAAAGGG - Intronic
943946854 2:194076703-194076725 TTATGCATCAGTTAAAAAATTGG + Intergenic
945272071 2:207950789-207950811 TTAGTCAATTTCTAAAAAACTGG + Intronic
945586842 2:211676233-211676255 TTACGTATCTTGTAAAAGACTGG - Intronic
946859988 2:223991690-223991712 CTTTTCATCTTTTAAAAAACTGG - Intronic
947292499 2:228592470-228592492 TTACTCATCTTCTACAAAAGAGG - Intergenic
947299548 2:228673784-228673806 TTATGAGACTACTAAAAAACAGG - Intergenic
948071117 2:235126950-235126972 AGATGCATCTTCTACAACACAGG - Intergenic
1173149312 20:40551949-40551971 TTGTGCATATTCAAAAAAATGGG + Intergenic
1173615922 20:44402955-44402977 TTCTGTATCTTCTACAAAACAGG + Intronic
1174909281 20:54589057-54589079 TTAAGCATCTTCCACCAAACTGG - Intronic
1175417001 20:58808318-58808340 TTATGGATTTTTTAAAAGACAGG + Intergenic
1176925617 21:14745483-14745505 CTATACATCTTCTAAAATCCAGG + Intergenic
1177938793 21:27383058-27383080 TTATTCAACCTTTAAAAAACAGG - Intergenic
1178791641 21:35705597-35705619 TTATACTTTTTCTAAAAAAAAGG + Intronic
1184900189 22:47441806-47441828 TTATGCAGCTTACAAAATACAGG + Intergenic
949545824 3:5071401-5071423 TTATTCATCCTCTAATACACGGG + Intergenic
951333758 3:21396510-21396532 TTATGCATTTTCCATTAAACTGG - Intergenic
951685189 3:25335951-25335973 TTATCCATCCTCTAAAACACAGG + Intronic
952551296 3:34480958-34480980 TTATTGACCTTCTACAAAACCGG - Intergenic
952735041 3:36680930-36680952 CCATGCATCTTCTGAAATACAGG + Intergenic
956719698 3:72106983-72107005 TGATTCATCTTCTATAAAATGGG - Intergenic
956898588 3:73689530-73689552 TTATGCCTTTCATAAAAAACTGG - Intergenic
957615785 3:82524914-82524936 TTATTCATATGCTAAAAAAGTGG - Intergenic
960247239 3:115413274-115413296 TTATGAATTTTTTAAAAATCAGG + Intergenic
961167961 3:124776579-124776601 TAATGCATCTTTAAAAATACGGG - Intronic
961206321 3:125085088-125085110 TTATACATGTTCTCAACAACTGG - Intronic
962299748 3:134228501-134228523 TTATTCAACTTTTAAAAAAATGG + Intronic
963007949 3:140743661-140743683 TTATTCATCTTCAAAAAGAAGGG + Intergenic
963967920 3:151394171-151394193 TCATGCCTCTGCTATAAAACAGG + Intronic
964064828 3:152564414-152564436 TTATACTTTTTCTAAAAGACTGG - Intergenic
966023742 3:175249445-175249467 TTATACCTTTTTTAAAAAACAGG - Intronic
968237798 3:197047220-197047242 GTGTGTATTTTCTAAAAAACAGG - Intronic
968423978 4:509046-509068 TTATGGAGCTTCTAAAAAATAGG - Intronic
971038048 4:22716788-22716810 TAATGCATTATCTAAATAACTGG - Intergenic
971435201 4:26614386-26614408 TTATTCTTTTTTTAAAAAACAGG + Exonic
971670934 4:29556971-29556993 TTATGCAGCTACCAAAAAAATGG - Intergenic
971783996 4:31077108-31077130 TTATGCATATTTAAAAAATCAGG + Intronic
972030777 4:34455227-34455249 TTATCAAGCTTGTAAAAAACAGG + Intergenic
972361214 4:38327052-38327074 ATATGTATTTTCTAAAAAGCAGG + Intergenic
974777795 4:66509695-66509717 TTATACATTTTCTTAAAAATGGG + Intergenic
976449517 4:85171714-85171736 TTATGCATCCTATAAGAAATAGG + Intergenic
977061404 4:92261496-92261518 TTATACATTTTTTAAAAAAATGG + Intergenic
977359689 4:95986301-95986323 GTATGCATCTTCTTAAAGAAGGG + Intergenic
979909061 4:126337052-126337074 CTATTCATCCTCTAAAAAACAGG + Intergenic
980156431 4:129113527-129113549 TTATGCATATTTTAAACAAAAGG - Exonic
980197312 4:129606765-129606787 TTATGTATCTTCTGCAAATCTGG - Intergenic
980204774 4:129703335-129703357 GTATGTAGCTTTTAAAAAACAGG + Intergenic
980602999 4:135050069-135050091 GAAGACATCTTCTAAAAAACTGG + Intergenic
980856982 4:138452328-138452350 TTTTTCATATTATAAAAAACAGG - Intergenic
981639418 4:146922190-146922212 AAGTGCATTTTCTAAAAAACAGG + Intronic
981674556 4:147326401-147326423 TTATACAGCTTCTACCAAACTGG + Intergenic
982122926 4:152159711-152159733 TTAGGTACCTTCAAAAAAACAGG + Intergenic
982885075 4:160768815-160768837 TTATACATATTTTAAATAACTGG - Intergenic
983406534 4:167338156-167338178 TTATGAATCTTCTAAGAAGATGG + Intergenic
984239618 4:177201915-177201937 TTAAACATTTTGTAAAAAACTGG - Intergenic
984772414 4:183448398-183448420 TTATGCATCTTTTAGAATACCGG + Intergenic
987682150 5:21150632-21150654 TTATGCATTATATAAAAAATTGG - Intergenic
988444072 5:31265404-31265426 TTATGCATCTTCTTGACAGCAGG - Intronic
990322010 5:54639260-54639282 TGATACACCTTCAAAAAAACTGG - Intergenic
990505988 5:56445918-56445940 TTATGTCCCTTCTAAATAACAGG + Intergenic
990521588 5:56586584-56586606 TTATGCAGCCTCTTAACAACTGG + Intronic
991171766 5:63634985-63635007 TTATTCAACTTTTAAAAAATAGG - Intergenic
992081452 5:73237119-73237141 CTATTCAACTTCTTAAAAACAGG + Intergenic
994065091 5:95530420-95530442 TTTTTCATCTTCTTAAATACTGG + Intronic
994640566 5:102403779-102403801 TTAAGCATCTGCAAAGAAACAGG + Intronic
994921105 5:106044936-106044958 TTATGCATCAGCTAGAAAACTGG + Intergenic
995115062 5:108470231-108470253 TAATGCAACTTCTAAAAAGTAGG + Intergenic
995204498 5:109463519-109463541 TTATGCTTCTTCGAAAGAATAGG - Intergenic
995815412 5:116162222-116162244 TTATGCAACTTCTGTATAACTGG - Intronic
996891428 5:128425651-128425673 TTTTGTATCTTCTAAATAAATGG + Intronic
997334121 5:133092688-133092710 ACTTGCATCTTCTGAAAAACAGG - Exonic
999733692 5:154496330-154496352 TTATCCATATTTTTAAAAACAGG - Intergenic
1000551725 5:162674440-162674462 TTATGCACATGCTAAAAAATGGG - Intergenic
1004833429 6:19502502-19502524 TTATTCATCTTTTAAAAAGAAGG - Intergenic
1005217237 6:23545164-23545186 TTATACATCTTATAAAAGTCTGG - Intergenic
1005297612 6:24442125-24442147 TTATTTATCTTTTAAAAAATAGG + Intronic
1006224930 6:32529419-32529441 TAAGGCATCCTCTAAAAACCTGG - Intronic
1006234984 6:32622010-32622032 TCATGCATCTTCTTATCAACTGG - Intergenic
1007151452 6:39696365-39696387 TTATGCACCTTCTAGGCAACAGG - Intronic
1008046559 6:46857524-46857546 TTATAGTTCTTCTAACAAACTGG + Intronic
1008593249 6:53014896-53014918 ACATGCATCTGTTAAAAAACTGG + Intronic
1010711252 6:79177336-79177358 TTATTCATCTTCAAAAAGAAAGG + Intergenic
1011425006 6:87218173-87218195 TTATGCATATTCCAATAAAAGGG - Intronic
1013825668 6:114208162-114208184 TAATGCTTCTTCTAAAAACTGGG + Intronic
1014864604 6:126512871-126512893 TTATGATTCTTCTCAAAACCAGG + Intergenic
1015652107 6:135475073-135475095 TTATATATCTTTTAAAAAAACGG - Intronic
1015974986 6:138780939-138780961 TTATGCATCTTCTAAAAAACTGG - Intronic
1016562831 6:145416225-145416247 CTATGCATCTTTTTCAAAACAGG + Intergenic
1017637593 6:156457673-156457695 TTATACATCTTCTAAAGAGATGG + Intergenic
1018345495 6:162894649-162894671 TTATGCAATTTTTAAAAAAATGG + Intronic
1018978019 6:168580284-168580306 AAATGTATGTTCTAAAAAACAGG - Intronic
1020870430 7:13622524-13622546 TTATTCAGCTTTTAAAAAGCAGG + Intergenic
1021832179 7:24625609-24625631 GTATGCTTATTCTTAAAAACTGG + Intronic
1022966792 7:35481647-35481669 TCATACCTCTTCTAACAAACTGG - Intergenic
1025525083 7:61796365-61796387 TTTTGCAGATTCTACAAAACAGG + Intergenic
1025548463 7:62208929-62208951 TTTTGCAGATTCTACAAAACAGG + Intergenic
1025702714 7:63834698-63834720 TTATGCACTGTTTAAAAAACTGG + Intergenic
1026171920 7:67961490-67961512 TTATGCATTGTTTAAAAAACTGG + Intergenic
1030401769 7:109059883-109059905 TCAGCCATCTTCCAAAAAACTGG + Intergenic
1030578883 7:111327023-111327045 TTATTCAGCTTCTAAAAAGAAGG + Intronic
1031119194 7:117701459-117701481 TTATACACCTTCTAAAAAATAGG - Intronic
1031516063 7:122700608-122700630 TTATTCATCTACTAGAAAAAAGG + Intronic
1031770886 7:125840823-125840845 TTAAGCATCTTTTTAAAAATAGG - Intergenic
1032627454 7:133607194-133607216 TCATGCATTTTTTAAAAATCAGG - Intronic
1032934069 7:136708993-136709015 TTTTCCATTTTCTAAAACACTGG - Intergenic
1032988973 7:137369797-137369819 TTATGCATCTTTTCAACTACAGG + Intergenic
1033178598 7:139151558-139151580 TTAAGCATCATCTGTAAAACAGG + Intronic
1033801498 7:144907436-144907458 ATATTCCTCGTCTAAAAAACAGG + Intergenic
1034138241 7:148791884-148791906 TAAAGTATCTTCTAAAAGACAGG - Intronic
1035490459 7:159272108-159272130 TTATGCAAGTGCTAAAATACTGG - Intergenic
1036563235 8:9915262-9915284 TTATGAAGCTTCTGAAAAATAGG + Intergenic
1037418282 8:18674690-18674712 TAATACATCTTCTTAAAAACAGG - Intronic
1039029068 8:33290110-33290132 GTATGCATCTTATTAACAACAGG - Intergenic
1040999110 8:53432399-53432421 TTATGCATGGACTAGAAAACAGG + Intergenic
1041504670 8:58582888-58582910 TTATGCATGATCTAGAAGACAGG + Intergenic
1042274447 8:66988633-66988655 TTATGCACCTTCTAAGTACCTGG - Intronic
1042848179 8:73189124-73189146 TTATGCAGTTTCTTTAAAACAGG + Intergenic
1042884626 8:73534812-73534834 TTATGCATCAACTAAAACACTGG - Intronic
1042951104 8:74201583-74201605 TTATGCATCTTGAAATAAAGAGG + Intergenic
1043538681 8:81234500-81234522 TTATGTGTCCTCTAAGAAACAGG + Intergenic
1044397786 8:91734171-91734193 TCATGCAGCTTCTAGCAAACCGG - Intergenic
1045577607 8:103442138-103442160 TTAAACATATTCTCAAAAACAGG - Intronic
1046196094 8:110864296-110864318 TTATTCATCTTAAAGAAAACTGG + Intergenic
1046307934 8:112395127-112395149 TCATATATCTTTTAAAAAACAGG - Intronic
1046429094 8:114099176-114099198 TTTGGCATTTTCTTAAAAACTGG + Intergenic
1046477283 8:114762279-114762301 ATATTCATCTTCTAAAAAGTAGG + Intergenic
1048104672 8:131394770-131394792 TTATGTCTCTTTTAATAAACTGG + Intergenic
1048863337 8:138740163-138740185 TTATTCATCTTGTAAATAACCGG - Intronic
1050872737 9:10594131-10594153 TTAGGCATATTCTACATAACAGG - Intronic
1051038743 9:12780430-12780452 TTATTCATTTTCTTAAAAAGGGG + Intronic
1052252853 9:26420273-26420295 TTATGCCTCTTTTACAAAAGAGG + Intergenic
1052326231 9:27219196-27219218 TATTGCATATTTTAAAAAACTGG + Intronic
1053650841 9:40168018-40168040 TTATATTTCTTCTAACAAACTGG - Intergenic
1053901230 9:42797371-42797393 TTATATTTCTTCTAACAAACTGG - Intergenic
1054533740 9:66208185-66208207 TTATATTTCTTCTAACAAACTGG + Intergenic
1054973874 9:71120610-71120632 TTATGCCTTTTCTAAAAACAAGG + Intronic
1055952113 9:81739100-81739122 TTTTCCCTCTTTTAAAAAACAGG - Intergenic
1056506117 9:87259912-87259934 ATATGCATCTTCTCATAAAATGG + Intergenic
1056878097 9:90357419-90357441 TTATGCATCTTACCAAAAGCTGG + Intergenic
1057606934 9:96505365-96505387 TCATTCATTTTCTAAGAAACTGG - Intronic
1058435149 9:104955753-104955775 TTATGCATTTTCAAAAACACAGG + Intergenic
1058564568 9:106268276-106268298 ATGTTCATCTTCCAAAAAACAGG + Intergenic
1059856185 9:118400190-118400212 TTATGCATTCTCTAAAATATGGG + Intergenic
1060784001 9:126434779-126434801 TTATGCTTCTTGTAAAACTCTGG + Intronic
1203441992 Un_GL000219v1:17460-17482 TCATGAATCCTCTAAAAAAATGG + Intergenic
1203512800 Un_KI270741v1:136369-136391 TCATGAATCCTCTAAAAAAATGG + Intergenic
1186047829 X:5555276-5555298 TCGTGCATCTTCTAAAATAGTGG - Intergenic
1186098611 X:6130539-6130561 TCCTGCCTCTTCTATAAAACTGG + Intronic
1186870659 X:13768042-13768064 TCAATCATCTTCTATAAAACAGG - Exonic
1186893231 X:13980683-13980705 TTATGCATCTTCTTACTAAGGGG + Intergenic
1188169447 X:26905502-26905524 TTGTGCATATTCAAAAAAAATGG + Intergenic
1188279533 X:28247641-28247663 TTATCTACCTTCAAAAAAACAGG + Intergenic
1189154208 X:38739875-38739897 TTATGCATCCTTCAAAATACAGG - Intergenic
1189475092 X:41346113-41346135 ATATATATCTTCTTAAAAACGGG - Intronic
1190003616 X:46713191-46713213 TTGTGCATTTTCTATATAACTGG - Intronic
1191157001 X:57284437-57284459 TTATTCAGCTTTTAAAAAGCAGG + Intergenic
1193780278 X:85693209-85693231 TTTTTTATCTTCTAAAAAAAAGG + Intergenic
1194090377 X:89577189-89577211 TAATGTAGCTTCTAAAAAAACGG - Intergenic
1194164194 X:90494681-90494703 TTGAACATCTTCTTAAAAACTGG + Intergenic
1194878006 X:99213431-99213453 ATATGTATCCTCTTAAAAACTGG + Intergenic
1194914917 X:99694317-99694339 TTATGCCTCATCTATAAAATAGG + Intergenic
1196776911 X:119346705-119346727 TAATGAATCATTTAAAAAACTGG + Intergenic
1197042043 X:121948856-121948878 TCATTCATCTTCTGAAATACAGG + Intergenic
1197440743 X:126486028-126486050 TTATGCATATTTTAAAGAATAGG - Intergenic
1197507577 X:127326595-127326617 TTATTCTTCTTCTCTAAAACAGG - Intergenic
1198156150 X:133962723-133962745 TTAAACATCTTCTGAAAGACAGG - Intronic
1198160298 X:134001425-134001447 CTATGTTTCTTCTAAAAAGCGGG + Intergenic
1200510454 Y:4072491-4072513 TTGAACATCTTCTCAAAAACTGG + Intergenic
1201055253 Y:9982545-9982567 TTTTTCAGCTTGTAAAAAACAGG - Intergenic
1201501477 Y:14648015-14648037 TCCTGCTTCTTCTATAAAACTGG - Intronic
1201947866 Y:19531300-19531322 CCATGCATCCTCTAAAATACAGG - Intergenic