ID: 1015976027

View in Genome Browser
Species Human (GRCh38)
Location 6:138791710-138791732
Sequence CAAGCTGACCACTTCCATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015976022_1015976027 26 Left 1015976022 6:138791661-138791683 CCTACCTAGAGTTACTCTCACCT 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1015976027 6:138791710-138791732 CAAGCTGACCACTTCCATAAAGG No data
1015976023_1015976027 22 Left 1015976023 6:138791665-138791687 CCTAGAGTTACTCTCACCTCCTT 0: 1
1: 0
2: 2
3: 20
4: 232
Right 1015976027 6:138791710-138791732 CAAGCTGACCACTTCCATAAAGG No data
1015976021_1015976027 29 Left 1015976021 6:138791658-138791680 CCTCCTACCTAGAGTTACTCTCA 0: 1
1: 0
2: 2
3: 7
4: 110
Right 1015976027 6:138791710-138791732 CAAGCTGACCACTTCCATAAAGG No data
1015976024_1015976027 6 Left 1015976024 6:138791681-138791703 CCTCCTTGTTCTCCTTATCACGT 0: 1
1: 0
2: 0
3: 14
4: 142
Right 1015976027 6:138791710-138791732 CAAGCTGACCACTTCCATAAAGG No data
1015976025_1015976027 3 Left 1015976025 6:138791684-138791706 CCTTGTTCTCCTTATCACGTTAC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1015976027 6:138791710-138791732 CAAGCTGACCACTTCCATAAAGG No data
1015976026_1015976027 -6 Left 1015976026 6:138791693-138791715 CCTTATCACGTTACATTCAAGCT 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1015976027 6:138791710-138791732 CAAGCTGACCACTTCCATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015976027 Original CRISPR CAAGCTGACCACTTCCATAA AGG Intronic
No off target data available for this crispr