ID: 1015977551

View in Genome Browser
Species Human (GRCh38)
Location 6:138806195-138806217
Sequence CTGAGCTACCATTTTAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015977551_1015977554 23 Left 1015977551 6:138806195-138806217 CCCAGCTTAAAATGGTAGCTCAG 0: 1
1: 0
2: 1
3: 12
4: 127
Right 1015977554 6:138806241-138806263 TGGTCCTTCTTACTTCAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 121
1015977551_1015977553 3 Left 1015977551 6:138806195-138806217 CCCAGCTTAAAATGGTAGCTCAG 0: 1
1: 0
2: 1
3: 12
4: 127
Right 1015977553 6:138806221-138806243 CTTTTTATTTCAAAATTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015977551 Original CRISPR CTGAGCTACCATTTTAAGCT GGG (reversed) Intronic
902825807 1:18973419-18973441 CTGAGCTAGCACATTAGGCTGGG - Intergenic
904681998 1:32235612-32235634 CTAAGAAACCATTTTAGGCTGGG - Intergenic
910291779 1:85606542-85606564 CTGAGGTAACATTTTCATCTTGG + Intergenic
912158411 1:106950800-106950822 CAGAGTTACAATTTTAAGCTTGG - Intergenic
913079409 1:115368503-115368525 CAGTGCTAGCATTTTTAGCTGGG - Intergenic
913139236 1:115923988-115924010 CTGTGCTATAATTTTAAGTTCGG - Intergenic
913173827 1:116256125-116256147 CTCAGCTCCTATTTTAGGCTTGG - Intergenic
913610111 1:120502672-120502694 CTGAGCTACCATTGCATGCTTGG - Intergenic
913984686 1:143554171-143554193 CTAAGCTACCATTGCATGCTTGG + Intergenic
914283282 1:146197828-146197850 CTGTGCTCCCATTTTATCCTAGG + Intronic
914544312 1:148648548-148648570 CTGTGCTCCCATTTTATCCTAGG + Intronic
914581079 1:149019567-149019589 CTGAGCTACCATTGCATGCTTGG + Intronic
914622320 1:149422462-149422484 CTGTGCTCCCATTTTATCCTAGG - Intergenic
917118109 1:171622808-171622830 CAGAGCTAGAATTTGAAGCTAGG - Intergenic
917372470 1:174309988-174310010 CTGAGCTTCCTTTTTTTGCTGGG + Intronic
918424144 1:184391366-184391388 CTCAGCTTCCATTTTAGACTGGG - Intronic
920237750 1:204519980-204520002 AAGAACTACCATTTTAGGCTGGG + Intronic
920239539 1:204535450-204535472 AAGAACTACCATTTTAGGCTGGG - Intronic
920714506 1:208326979-208327001 CTGAGTCACCTTTTTAATCTTGG + Intergenic
921236210 1:213133792-213133814 TTGAGCTACGATTTTAATCTAGG + Intronic
922138947 1:222862025-222862047 CTGAGCAACCCTTTTAAGACTGG + Intergenic
922579491 1:226686386-226686408 CTGAGATACCATTATTAGATTGG + Intronic
1065935712 10:30518752-30518774 CTGAGGAGCCATTTTAAGCATGG - Intergenic
1070808257 10:79283555-79283577 CACAGCTGCCATTTTTAGCTCGG + Intronic
1071493903 10:86154779-86154801 CAGAGCTGCCATCGTAAGCTGGG + Intronic
1074252140 10:111761523-111761545 CTGGGCCACCATTTTAAGACAGG + Intergenic
1074653553 10:115555857-115555879 ATGATCTAACATTTTAAGTTAGG + Intronic
1076334778 10:129698519-129698541 CTAAGCAACTAATTTAAGCTGGG + Intronic
1085069757 11:73532897-73532919 CTGAACTTCAATTTTCAGCTGGG + Intronic
1090853004 11:130586978-130587000 CTGAGCCACCATTTTATGGCTGG + Intergenic
1091002701 11:131923855-131923877 CTGAGCCAGCATTTGAAACTGGG - Intronic
1091721657 12:2818396-2818418 CTGAGCTCCCATGATAAGCCAGG + Intronic
1093633958 12:21442424-21442446 CTCAGCTGCCATTGAAAGCTAGG - Intronic
1093634578 12:21449687-21449709 CTCAGGTAACATTTTAAGGTTGG + Exonic
1094787520 12:33865791-33865813 CTGAGTTGCAATTTGAAGCTGGG - Intergenic
1095043835 12:37476492-37476514 CTGAGCTACGATTTTCTTCTTGG - Intergenic
1095839855 12:46681318-46681340 CTGAGCTATCATTTTGTACTGGG + Intergenic
1096724678 12:53551874-53551896 CTGCTGTACCATTTTCAGCTAGG - Intronic
1097724648 12:63061253-63061275 CAGAGCTAGGATTTTAATCTGGG - Intergenic
1098232010 12:68381043-68381065 CTGCTCTACCATTTTTAGATTGG + Intergenic
1100062952 12:90604189-90604211 CTGTGTTCCCATTTCAAGCTAGG + Intergenic
1101764315 12:107684150-107684172 CTGAGCCACCATATAAAGTTTGG - Intergenic
1102736902 12:115170183-115170205 CTCAGCTATCATTTGGAGCTTGG - Intergenic
1103626535 12:122224799-122224821 CTGAGGCAACATTTTAAACTTGG - Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1113361141 13:109632624-109632646 GTGAGCCACCATTTTAAAATGGG - Intergenic
1115900592 14:38143102-38143124 CTGAGCACCCATTATATGCTGGG + Intergenic
1116327845 14:43555609-43555631 ATGAACTACAATTTTAAGTTTGG - Intergenic
1118090623 14:62472898-62472920 CTCTACTACCATTTGAAGCTAGG - Intergenic
1118675028 14:68174770-68174792 CTGACCTACCTATTTAAACTTGG + Intronic
1122914218 14:104849670-104849692 CTGAGCTGCCACTTTCTGCTTGG + Intergenic
1123134342 14:106013054-106013076 CTGAGCCACCATTTTAACTAAGG + Intergenic
1123584367 15:21743498-21743520 CTGAGCCACCATTTTAACTAAGG + Intergenic
1123621014 15:22186105-22186127 CTGAGCCACCATTTTAACTAAGG + Intergenic
1123985807 15:25644905-25644927 ATGAGCTGCCATTTTAATCAGGG - Intergenic
1126120388 15:45246328-45246350 TTGAGCTACCATGCTCAGCTAGG + Intergenic
1126527361 15:49671274-49671296 CTAAGCTACCAGGTTAAGCATGG - Intergenic
1127290386 15:57565300-57565322 CTGAGCTCCCACTCTATGCTGGG + Intergenic
1129095901 15:73207493-73207515 CTGAGGTGGCATTTAAAGCTGGG - Intronic
1133785022 16:8966806-8966828 CTGAGCATCCACTGTAAGCTTGG - Intergenic
1135103752 16:19629147-19629169 GTGAGCTACCATGTTCAGCTTGG - Intronic
1137515703 16:49141766-49141788 CTGGGCATCCATTTTCAGCTTGG - Intergenic
1138297016 16:55895577-55895599 CTGTGCTACCATTGTTATCTTGG + Intronic
1140047595 16:71452668-71452690 CTGAGCACACATTATAAGCTAGG + Intronic
1140987588 16:80173395-80173417 CTGAGCTACCATTTTCTCATCGG + Intergenic
1141560535 16:84864856-84864878 CTGAGCTCCAATTCTAATCTTGG - Intronic
1147491540 17:40872024-40872046 CTGAGGTACAATTTTGAACTTGG - Intergenic
1148487496 17:48000238-48000260 CTGAAATACGATTTTAAGCCTGG - Intergenic
1150197583 17:63317005-63317027 ATGAGTTATCATATTAAGCTTGG + Intronic
1151999328 17:77635452-77635474 CTGAGCAACCATTGTACCCTAGG - Intergenic
1152175836 17:78786597-78786619 CTGAGCGACCACCTTAAACTTGG - Intergenic
1155855395 18:30828379-30828401 CTGTGATACCATTCTGAGCTAGG + Intergenic
1157041651 18:44046436-44046458 CTGAGATAACATTTAAATCTTGG - Intergenic
926902288 2:17765892-17765914 CTGAGCTATCATTAATAGCTTGG - Intronic
927133196 2:20078201-20078223 CTGTGCTCCTATTTTATGCTAGG - Intergenic
927234036 2:20853472-20853494 CTTAGCTAGCATTTAAAGTTGGG - Intergenic
928287930 2:30009396-30009418 CTGTGCTCCCATCTTCAGCTTGG + Intergenic
929490374 2:42391007-42391029 CTGAGCTCCCAGGTTCAGCTGGG + Intronic
929908841 2:46071511-46071533 CTGAGCTAGGATTTTAACCCAGG + Intronic
931155805 2:59627683-59627705 CTGAGCTACCATTTTATTCTTGG - Intergenic
932421653 2:71604844-71604866 CTGAGCTAGCTTTTGAAGTTGGG + Intronic
936779073 2:116010112-116010134 TTGAGCTACAATTTTAAATTTGG - Intergenic
939666658 2:144961257-144961279 CTGAGCTATCTTATTATGCTAGG - Intergenic
940684868 2:156834892-156834914 CTGAGCTTCTACATTAAGCTTGG - Intergenic
940714941 2:157210975-157210997 CTGAGTTACTATTTGGAGCTAGG - Intergenic
941009902 2:160287450-160287472 CTAAGGGACCATTTTAAGTTGGG - Intronic
941566929 2:167120435-167120457 CTGTGCTATCATTCAAAGCTAGG - Intronic
942219541 2:173755892-173755914 CTGAGATAGCTTTTTAAGCCTGG + Intergenic
943122073 2:183748991-183749013 CTGAGCTATACTTTTAAGCAGGG + Intergenic
947970951 2:234324155-234324177 ATGAGCCACCATATTAATCTGGG - Intergenic
1169516662 20:6323556-6323578 CTGAGGGACCATTTTAAGTAGGG + Intergenic
1172610029 20:36243852-36243874 CAGAGCTAAGATTTGAAGCTAGG + Intronic
1173090753 20:39968789-39968811 CTGGGCTGCCATTTCAAGCAAGG + Intergenic
1177372081 21:20217785-20217807 CTGGGCTCCAGTTTTAAGCTGGG - Intergenic
1177967028 21:27740459-27740481 CCAAGCTCCCATTTTAACCTAGG - Intergenic
1181478623 22:23183462-23183484 CTGATCTTCCATTTGCAGCTGGG + Intronic
1181961074 22:26622205-26622227 CAGAGCTACCTCTTTGAGCTAGG + Intronic
949857352 3:8473922-8473944 TTGAGCTAACATTTTAATCAAGG - Intergenic
951908860 3:27729327-27729349 CCAGGCTACCATTTTCAGCTGGG - Intergenic
957515349 3:81243771-81243793 CTGAGCCACCATATTATGATGGG + Intergenic
959154437 3:102649439-102649461 CTGGGCTACCATTTTATTCTTGG + Intergenic
959516402 3:107271836-107271858 CTAAGTAACCATTTTAGGCTGGG - Intergenic
961745721 3:129062371-129062393 CTGAGCTGCCAGTTTATTCTGGG - Exonic
962084591 3:132177079-132177101 CAGAGCTACCATTTGAACCATGG + Intronic
964016726 3:151956724-151956746 CTGAGCCACTATTTTAAGACTGG - Intergenic
966883181 3:184361300-184361322 CTGTCCTAGCATTTTGAGCTGGG - Intronic
971571661 4:28219654-28219676 CTGAGCAAACATTTTCAGATTGG - Intergenic
980515995 4:133862069-133862091 CTGGGCTGCCATTTTAAGCCAGG + Intergenic
981724087 4:147829843-147829865 CTGGGCAACCATTTTAGGCTAGG - Intronic
987995386 5:25270482-25270504 ATGAGATACCATTTTAAATTTGG - Intergenic
989814646 5:45721513-45721535 CAGTGCTACCATTTTACTCTGGG + Intergenic
991206669 5:64057867-64057889 CTGAGCCACCATTTGAAGGGAGG + Intergenic
991414224 5:66375870-66375892 CTAGTCTAGCATTTTAAGCTTGG - Intergenic
993129556 5:83878309-83878331 CGGAGATACCATTTTAGGATTGG + Intergenic
1001723723 5:173878297-173878319 CTGACCTTCCATCTTAACCTGGG + Intergenic
1010678519 6:78771914-78771936 CTGTGCTTTCATTTTATGCTAGG - Intergenic
1015274787 6:131373052-131373074 CAGAGATACCATTTCAAGATAGG + Intergenic
1015528229 6:134193918-134193940 CTGAGCTGCCAGGATAAGCTTGG - Intronic
1015977551 6:138806195-138806217 CTGAGCTACCATTTTAAGCTGGG - Intronic
1016069367 6:139721090-139721112 CTAGGCTACCATTTTCTGCTTGG + Intergenic
1017452317 6:154565517-154565539 CTGAGCTACCATCATGAGCTGGG + Intergenic
1017631010 6:156396745-156396767 CTGTTCTACCAATTGAAGCTTGG + Intergenic
1020817421 7:12922844-12922866 CTGAGGCACCATATTAAGCTGGG + Intergenic
1022810755 7:33866099-33866121 TTGAGCTACTTTTTTATGCTGGG - Intergenic
1025038952 7:55622649-55622671 CTGAGCTATCATTTTCAGAGAGG + Intergenic
1030616678 7:111744574-111744596 CTGAGCTACCATTTAATTCTGGG + Intronic
1031080009 7:117249169-117249191 CTGACTTACCATTTTACACTGGG + Intergenic
1032857146 7:135844405-135844427 ATGAGCTACAGTTTTAAGCAGGG + Intergenic
1033137836 7:138799325-138799347 CTGAGCTCCCATCATAAGCAAGG - Intronic
1043176126 8:77025439-77025461 ATGAGCTACCATCTCATGCTAGG + Intergenic
1046900328 8:119516757-119516779 CAGAGCTATCATTTGAACCTAGG - Intergenic
1055496123 9:76857419-76857441 CTGGTCCACCATTCTAAGCTGGG - Intronic
1057427195 9:94961988-94962010 CTGAGCTACAGTTTGAAACTTGG + Intronic
1058410030 9:104721574-104721596 CTAAGCTACCAGTTTCAGCTAGG - Intergenic
1058998805 9:110326667-110326689 CTGATCTAGCATTTTAAGTAAGG + Intronic
1059302843 9:113329343-113329365 TTAATCTACCATTTCAAGCTGGG + Intronic
1061920706 9:133780801-133780823 CTCACTTACCATCTTAAGCTCGG - Intronic
1062733017 9:138120007-138120029 CTGGGCTACCATTTCAGGCCTGG + Intronic
1185447259 X:265606-265628 CTGTGTTACAATTTTAAGCGTGG + Intergenic
1192259911 X:69499457-69499479 CTGAACAACCCATTTAAGCTAGG - Intergenic
1198077470 X:133207674-133207696 CTTAGCTACCATGTCATGCTAGG + Intergenic