ID: 1015983001

View in Genome Browser
Species Human (GRCh38)
Location 6:138857764-138857786
Sequence GGAGAGTGCGTATGTGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015983001 Original CRISPR GGAGAGTGCGTATGTGGAAA AGG (reversed) Intronic
900338411 1:2176047-2176069 GGAGAGTGAGTCTGTGGACAGGG + Intronic
903661928 1:24983707-24983729 GGACAGTGGCTTTGTGGAAAGGG + Intergenic
904604162 1:31689862-31689884 GGAGAGGCAGTATGTGGACAGGG + Intronic
906556748 1:46719917-46719939 GGGGAGTGCCTCTGTGAAAAGGG + Intergenic
910841099 1:91561921-91561943 GGAGAGTGCGAGTGTGGGGAAGG - Intergenic
911191867 1:94956354-94956376 GGGGAGTGCATATGGAGAAATGG + Intergenic
911627514 1:100141774-100141796 GGAGAATGACTATGTAGAAAAGG + Intronic
912507834 1:110168302-110168324 GGGGACTGCGTCTTTGGAAAAGG - Intronic
915274599 1:154779483-154779505 GGAGAGTGGGGATGGGGGAATGG - Intronic
915622149 1:157092470-157092492 GGAAGGTGTGAATGTGGAAATGG - Exonic
918205050 1:182300718-182300740 GGAGGGTGGGTGGGTGGAAAGGG + Intergenic
923351970 1:233116959-233116981 GGAAACTGCGTATGTAGAAAGGG + Intronic
1062831004 10:605921-605943 GCAGGATGCATATGTGGAAATGG - Intronic
1063031848 10:2243634-2243656 GGCCAGTGCGTATGTGCACAGGG + Intergenic
1067349221 10:45460765-45460787 GGAGTGTGAGTAGGTGGATAGGG - Intronic
1067947327 10:50697989-50698011 GGAGAGTCTGCATGTGGACAGGG - Intergenic
1068881113 10:62049596-62049618 GGAGAGAGCGGGTGTGGGAAGGG + Intronic
1068897607 10:62224791-62224813 GCAGAGTGAGTATCTGCAAAGGG + Intronic
1069683004 10:70298728-70298750 GGAGACTGTGTATCTGGGAAAGG - Intergenic
1070357699 10:75656666-75656688 GGAGAGTGTCTGTGTAGAAAAGG - Intronic
1070882639 10:79862974-79862996 GGAGAGTCTGCATGTGGACAGGG - Intergenic
1071111640 10:82164520-82164542 GGAGGGTGTGTGTGTGTAAAGGG - Intronic
1071649206 10:87379276-87379298 GGAGAGTCTGCATGTGGACAGGG - Intergenic
1071878326 10:89866558-89866580 GGAAAGTGCTTTTGTGGGAAGGG + Intergenic
1073936714 10:108641092-108641114 GGAAAGTGAGTAGGTTGAAATGG + Intergenic
1075906398 10:126085553-126085575 GGATAATGGGTAGGTGGAAATGG - Intronic
1076759420 10:132594116-132594138 GAAGACAGCGTATGTGCAAAAGG - Intronic
1080382538 11:31788469-31788491 GGAGAGGGCCTATTTGAAAAAGG + Exonic
1081508564 11:43743973-43743995 GGAGAGTGAGAGTGTGCAAAAGG + Intronic
1081750304 11:45505840-45505862 GGAGAATGAGGAGGTGGAAAAGG + Intergenic
1081892459 11:46555120-46555142 GGAGTATGTGTGTGTGGAAATGG - Intronic
1083552274 11:63598909-63598931 TGAGTGTGCGTATGTGAGAAGGG + Intronic
1083629325 11:64087659-64087681 GGAGAGTGAATATGAGGACAAGG - Intronic
1083948327 11:65938959-65938981 GGGGAGTGGGTGGGTGGAAAAGG + Intergenic
1084033199 11:66492968-66492990 GGAGGGTGTGTGTGTGGACAGGG - Intronic
1085074112 11:73574390-73574412 AGTGAGTGCATATGTGGAAAGGG - Intronic
1085313601 11:75530434-75530456 TAAGAGTGTGTATGTGGAATGGG + Intergenic
1085896448 11:80645351-80645373 TGAGAGTGCAGATTTGGAAATGG - Intergenic
1086905734 11:92416040-92416062 GGAGACTGCCTGTGTGGAGATGG - Intronic
1087639283 11:100738314-100738336 TGAGAGTTCATATGTGGAAAGGG + Intronic
1088002641 11:104900791-104900813 GGACAGTGGGTAGGAGGAAATGG - Intergenic
1088108810 11:106237115-106237137 GGTGAGTTTGTATGTGGATATGG - Intergenic
1088938574 11:114430351-114430373 GGAGAGTGCCTATATTTAAATGG - Intronic
1089131000 11:116211911-116211933 GGAGAGTATGCATGTGGAAATGG - Intergenic
1089456778 11:118630323-118630345 GGTGGGTGTGTATGTGGAGAGGG + Intronic
1090228543 11:125085790-125085812 GGAGAGTGCTTCTGAGCAAAGGG - Intronic
1093381288 12:18497010-18497032 GGAGATTGCATATGTCCAAAGGG - Intronic
1094075882 12:26473817-26473839 GGAGATTTAGGATGTGGAAAAGG - Intronic
1094090703 12:26645892-26645914 AAAAAGTGTGTATGTGGAAATGG - Intronic
1096630663 12:52924972-52924994 GGAGGATGCGTCTGTGGAAAAGG + Intronic
1096792383 12:54053276-54053298 GGTGAGTGTGTATGGGGAAGAGG + Intronic
1097687402 12:62703748-62703770 GGAGAGTGGGTGTGGGGAGAGGG - Intronic
1098309901 12:69138235-69138257 GGAGGGTGAGGATGTGGGAAGGG - Intergenic
1098313633 12:69171660-69171682 GGAGAGTGCTTCTGGGGAGAGGG - Intergenic
1100508433 12:95243890-95243912 CGGGAGTGGGTATGTGCAAAGGG - Intronic
1104553995 12:129783420-129783442 GGAGGATGTGTATGTGGCAAAGG - Intronic
1107047110 13:36005243-36005265 TAAGAGTGAGTATTTGGAAAGGG + Intronic
1110168398 13:72471106-72471128 GGAGAGTGTGAATGTTAAAAGGG + Intergenic
1113420255 13:110165548-110165570 GGAGGGAGGGTATGTGGAAGGGG - Intronic
1115108732 14:29794427-29794449 AAAGAGTGTGTATGTGGAAGGGG - Intronic
1116773480 14:49153269-49153291 GGACAGGGCGCATGTGCAAATGG - Intergenic
1118709365 14:68507058-68507080 GGAGAGTGTGTATGTGGAGGGGG + Intronic
1119892012 14:78189897-78189919 GGAAAGTGCTGTTGTGGAAAGGG - Intergenic
1120133439 14:80835130-80835152 GGGGAGTGGGGATGTGTAAAGGG - Intronic
1121110250 14:91307668-91307690 GAAGAGTGCGTGTGTGGAAGGGG + Intronic
1122356302 14:101124994-101125016 GGGGAGTGCGTATGTGGGTGTGG - Intergenic
1122442073 14:101738888-101738910 GGAGAGGGGGGAAGTGGAAAGGG + Intergenic
1125421746 15:39511240-39511262 GGAGAGATGGTATGGGGAAAGGG + Intergenic
1129412540 15:75358131-75358153 GGAGACTGCTTGTGTGGAACAGG - Intronic
1129675816 15:77632110-77632132 GGAGAGAGGGGAGGTGGAAAAGG + Intronic
1130173597 15:81544255-81544277 GGAGAGTGCGTTTATGGAGAGGG + Intergenic
1133118873 16:3594339-3594361 GGAGAGTGGGGGGGTGGAAAGGG + Intronic
1134380738 16:13722977-13722999 GGAGACTACGTATGTAGAACTGG - Intergenic
1138255691 16:55557390-55557412 GGAAAGTGGGTATGTGTATAAGG - Intronic
1140512717 16:75519692-75519714 GTAGGTTGCGTATCTGGAAAGGG + Intergenic
1140961684 16:79918835-79918857 GGAGTTTGGGTTTGTGGAAAGGG - Intergenic
1141870166 16:86779832-86779854 GGACTGTGGGTATGTGGACAGGG - Intergenic
1142529085 17:566567-566589 GGAGGGTGGGAAGGTGGAAACGG + Intronic
1143411888 17:6713959-6713981 GGAGAGTGCGAGCGGGGAAAAGG - Intergenic
1149587495 17:57802315-57802337 GGAGAGTGGGCATGTGGAGCTGG - Intergenic
1151140315 17:71985433-71985455 GGAGAATGTGTGTGTGGAGAAGG - Intergenic
1152041410 17:77906237-77906259 GGAGAGTGAGTAGGTGGGGAGGG - Intergenic
1152815180 17:82403747-82403769 GGTGAGCGCGCATGTGGACAGGG - Intronic
1152815187 17:82403789-82403811 GGTGAGTGCGTACGTGGGCAGGG - Intronic
1153128439 18:1825481-1825503 GGGGACTGAGTATGTGGTAAAGG - Intergenic
1153543687 18:6184734-6184756 GAAGAGTGCATACGTGGAAGGGG + Intronic
1156012300 18:32509285-32509307 GCAGAGTGTGTAGGAGGAAACGG - Intergenic
1157124148 18:44938848-44938870 GGAGAGTGAGGATCTGGGAAGGG + Intronic
1160527519 18:79546260-79546282 GGAGAGGGTGAATGTGGAGAGGG - Intergenic
1160527529 18:79546320-79546342 GGAGAGGGTGAATGTGGAGAGGG - Intergenic
1160527539 18:79546365-79546387 GGAGAGGGTGAATGTGGAGAGGG - Intergenic
1160527545 18:79546395-79546417 GGAGAGGGTGAATGTGGAGAGGG - Intergenic
1160527555 18:79546440-79546462 GGAGAGGGTGAATGTGGAGAGGG - Intergenic
1160527563 18:79546485-79546507 GGAGAGGGTGAATGTGGAGAGGG - Intergenic
1160527579 18:79546560-79546582 GGAGAGGGTGAATGTGGAGAGGG - Intergenic
1160527588 18:79546605-79546627 GGAGAGGGTGAATGTGGAGAGGG - Intergenic
1160527597 18:79546650-79546672 GGAGAGGGTGAATGTGGAGAGGG - Intergenic
1160527605 18:79546695-79546717 GGAGAGGGTGAATGTGGAGAGGG - Intergenic
1161192948 19:2969459-2969481 GAAGAGTGAGTTTGTGGAAGTGG - Intergenic
1162314639 19:9930941-9930963 GGCGCGTGCGTATGTGGGATGGG - Intronic
1162340206 19:10087221-10087243 GGAGAGTGCATATAAGGGAAGGG - Intronic
1162373135 19:10290661-10290683 GGAGAGTGCGTTTGCGGCAAGGG - Intronic
1163511110 19:17735586-17735608 GGAGGGTGGGTAGGTGGAAGTGG - Intergenic
1164423175 19:28115764-28115786 TGAGACTGCGTAATTGGAAATGG + Intergenic
1165096465 19:33412437-33412459 GGAGAGGGCCTCTATGGAAAGGG + Intronic
1168007966 19:53506384-53506406 AGAGAGTGTGTATGTGGTAGGGG - Intergenic
925545727 2:5013849-5013871 GGAGAATTTGTATGTGGGAATGG - Intergenic
926294308 2:11557548-11557570 CGTGAGTGTGTATGTGGAAGGGG + Intronic
927263507 2:21118219-21118241 GGAGAGTGAGTGTGGGGAAGGGG + Intergenic
927557763 2:24048030-24048052 GGAGAGTGGGGATGAGGAAATGG + Intronic
932159140 2:69444925-69444947 GGACAATGCGTATGTTGATAAGG - Intergenic
932663829 2:73680316-73680338 GGGGAGTGGGCATGGGGAAAAGG + Intergenic
936013275 2:108939434-108939456 AGAGTATGCGTATGTGAAAATGG + Intronic
938418984 2:131128464-131128486 GGTGAGTGTGTATGGGGACAGGG - Intronic
938630074 2:133156919-133156941 GGAGAGTTCATATGAGGGAATGG - Intronic
942198230 2:173544158-173544180 GGAGAGAGAGACTGTGGAAAAGG - Intergenic
942690778 2:178582609-178582631 GAAGAGTGAATATGTGGAATGGG + Intronic
945798168 2:214390633-214390655 GGAGTGTGGGGAGGTGGAAAGGG - Intronic
946540551 2:220679801-220679823 GTAGTGTGGGTTTGTGGAAAAGG + Intergenic
947165483 2:227257421-227257443 GGAGAGCGCGTATCTGGGTAAGG - Intronic
948784600 2:240345850-240345872 GGTGACTGTGTAAGTGGAAAAGG - Intergenic
1169072817 20:2743592-2743614 AGTGCGTGCGTATATGGAAAGGG + Intronic
1170619509 20:17983048-17983070 GGAGAGTGGGGAAGAGGAAAGGG - Intronic
1170639470 20:18138566-18138588 GGAGAGTGAGTACGGGGAAGGGG - Intronic
1171101057 20:22384367-22384389 GGAGAGTGGGGTTGTGGGAAGGG - Intergenic
1171113133 20:22502231-22502253 GGAGAGTGGAGATTTGGAAAGGG - Intergenic
1175860324 20:62147075-62147097 CGAGAGTGCGTTTGTGGTGAGGG + Intronic
1175875949 20:62229812-62229834 TGAGAGTGTGTGTGTGGAATGGG - Intergenic
1179281207 21:39935902-39935924 GGTGAGTAGGTATGTGGGAAGGG - Intergenic
1179914192 21:44465823-44465845 GGAGAGTGTGTGTGTGTACAGGG - Intergenic
1181042685 22:20199784-20199806 GGACAGTGAGTAGGTGAAAATGG - Intergenic
949333228 3:2945491-2945513 AGAGAGAGTGTCTGTGGAAAAGG - Intronic
951645256 3:24882920-24882942 GGTGAGGGGGTATATGGAAAGGG + Intergenic
952930368 3:38355573-38355595 GGAGAGTGCCTAGGAAGAAAGGG - Intronic
954414040 3:50384307-50384329 TGAGAGTGAGGATGTGGAAAGGG - Exonic
955334739 3:58075860-58075882 GGAGAGTGGGTATAGGGAAACGG + Intronic
955557318 3:60151841-60151863 GGATAGTGAGTATTAGGAAAGGG - Intronic
956124397 3:65997767-65997789 GGAGAGGGTGTGTGTGGAGAGGG - Intronic
956746182 3:72312626-72312648 GGAAAATGCGTTTGTTGAAAGGG - Intergenic
958099604 3:88991476-88991498 GGATAGTGCTAATTTGGAAAAGG - Intergenic
961096736 3:124163225-124163247 GGAGAGTGAGTATGTTGAACAGG + Intronic
961215420 3:125156158-125156180 GGAGAGGCCATGTGTGGAAAAGG + Intronic
961666216 3:128494472-128494494 AGAGAGTGTGTCTGTGGAAATGG + Intergenic
963850737 3:150208016-150208038 GGTGAGTGAGTTTGGGGAAAAGG + Intergenic
966666718 3:182479853-182479875 GGAGAGTGGGAGTGGGGAAAAGG + Intergenic
966878697 3:184337770-184337792 GTAGGGTGCTTAGGTGGAAAAGG + Intronic
970965167 4:21919648-21919670 GGAAAGTGAGTATTTGGCAAAGG - Intronic
971240418 4:24883518-24883540 TGAGAGTGAGTAGGTGTAAAAGG + Intronic
974715374 4:65662704-65662726 TGAGAGTGTGTATGTGGGCAGGG + Intronic
977964766 4:103132181-103132203 GGAGATTGTGTTTGTGGAGATGG + Intronic
979501888 4:121449883-121449905 GCAGAGTGTGTATGTGGAGAAGG + Intergenic
981362033 4:143857922-143857944 GGAAAGTGAGTATATTGAAAAGG + Intergenic
981372768 4:143978758-143978780 GGAAAGTGAGTATATTGAAAAGG + Intergenic
981381855 4:144081996-144082018 GGAAAGTGAGTATATTGAAAAGG + Intergenic
982965064 4:161896457-161896479 GGTGTGTGTGTATGTGGAAGGGG - Intronic
983564396 4:169133960-169133982 GATCAGTGCGTATGGGGAAATGG - Intronic
985913498 5:2900707-2900729 GGAGAGGGAGAAGGTGGAAAGGG - Intergenic
986572706 5:9181711-9181733 CGACAGTGAGTATGTGGAGATGG + Intronic
990344683 5:54860120-54860142 TGTGATTGCCTATGTGGAAAGGG - Intergenic
990759229 5:59110135-59110157 GGAGAATGCGTATGTTGGCAAGG + Intronic
991153048 5:63394927-63394949 AGAGAGTGTGTATTTGGAACTGG - Intergenic
994526119 5:100906659-100906681 GGAGACTGAGTATGGGGAGAAGG - Intergenic
994650424 5:102520176-102520198 GGACAGTGAGTATGTGGTAGTGG - Intergenic
996015948 5:118534285-118534307 GGAGAGTGTGTATGTGTTACTGG - Intergenic
997985925 5:138501666-138501688 GTGGAGTGCGTCTGTGGAGAAGG + Intergenic
998359021 5:141568379-141568401 GGAAAGTGAGAATGTGAAAAAGG + Intronic
999060364 5:148627377-148627399 AGAAAAAGCGTATGTGGAAATGG - Intronic
999196805 5:149787076-149787098 GGAAAGAGCCTGTGTGGAAATGG - Intronic
1001877388 5:175213352-175213374 GGGGAGTGCATAAGGGGAAAAGG - Intergenic
1001972485 5:175967816-175967838 GGAGAGTGGGTTTGAGGGAAGGG - Intronic
1002244954 5:177875964-177875986 GGAGAGTGGGTTTGAGGGAAGGG + Intergenic
1004449329 6:15730577-15730599 ACAGAGTGCTTATTTGGAAAAGG - Intergenic
1005820034 6:29590685-29590707 GGAGACAGCGTATGTGGGATTGG - Intronic
1006442628 6:34061741-34061763 GGTGAGTGGGTATGTGGGCAGGG - Intronic
1006868929 6:37232656-37232678 AGGGAGTGTATATGTGGAAATGG - Intronic
1007106307 6:39285460-39285482 GGAGAGTGGGTGTGTGGGATGGG + Intergenic
1010107439 6:72186464-72186486 AGATAGTGCTTATGTAGAAAAGG + Intronic
1014003208 6:116387936-116387958 GGAGAGTGAGTACTAGGAAAGGG + Intronic
1014821872 6:125998226-125998248 GTAGAGTCCGAATGTAGAAATGG - Exonic
1014974223 6:127859132-127859154 GGAGAGTGCATTTGAGTAAAGGG - Intronic
1015983001 6:138857764-138857786 GGAGAGTGCGTATGTGGAAAAGG - Intronic
1016075585 6:139791940-139791962 GGAGAATACATATGTGCAAATGG - Intergenic
1016956303 6:149630232-149630254 TGAAAGTGCGTATGAGGCAAGGG + Intronic
1017794122 6:157825809-157825831 GGAGTGTGCATATGGGGGAAGGG - Intronic
1018842783 6:167530448-167530470 GGAGAGAGACAATGTGGAAATGG + Intergenic
1020979368 7:15048378-15048400 GGACAGTGGGTAGGAGGAAATGG - Intergenic
1029348179 7:99993725-99993747 GGAGAGTGAGGGTGTGGAATGGG - Intergenic
1030485935 7:110167717-110167739 GGAGAGTGGGAGTGGGGAAAGGG - Intergenic
1033109739 7:138563432-138563454 AGAGGGTGCGGATGTGGACACGG - Intronic
1036844033 8:12149840-12149862 GGAGAGTCCATATGAGGAATGGG + Intergenic
1037866143 8:22444035-22444057 GAAGAGTGGGTATGTGGGAGAGG + Intronic
1038261460 8:25999683-25999705 GGAGAGGGCGTGTGTGGATATGG - Intronic
1042333154 8:67603961-67603983 GCAGAATTTGTATGTGGAAAGGG + Intronic
1053277056 9:36791049-36791071 GGATAGTGGCAATGTGGAAAGGG - Intergenic
1055181951 9:73399591-73399613 TGTGAGTCCTTATGTGGAAAAGG - Intergenic
1057049390 9:91911109-91911131 GTAGTGTGCAGATGTGGAAATGG - Intronic
1057694434 9:97313324-97313346 GGAGATTGCGCAGGTGGGAAAGG + Exonic
1058293191 9:103271088-103271110 AGAAAGTGCATATGTGGAAAAGG - Intergenic
1058912881 9:109536982-109537004 GGAGTGTGCGTTTGAGGGAAGGG + Intergenic
1059234883 9:112752443-112752465 GCTGTGTGCGTATGTGGAAACGG - Intronic
1185461354 X:334069-334091 GGGGCCTGCGTCTGTGGAAAGGG - Exonic
1185520715 X:736498-736520 GGAGAGTGGGGATGAGGAGATGG - Intergenic
1186515422 X:10163280-10163302 GGAAAGTGTGTATGGGGGAAGGG - Intronic
1189533452 X:41910775-41910797 GGAGTGTGGGTATCTGGAGAGGG - Intronic
1195594307 X:106671066-106671088 GGTGAGTGAGTTGGTGGAAAGGG - Intronic
1196136771 X:112218416-112218438 GGAGAGAGCCTATGGAGAAAGGG - Intergenic