ID: 1015983567

View in Genome Browser
Species Human (GRCh38)
Location 6:138863514-138863536
Sequence GAGCCAAATGTGCTACCGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015983567_1015983571 14 Left 1015983567 6:138863514-138863536 CCAAACGGTAGCACATTTGGCTC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1015983571 6:138863551-138863573 CTGGCCTAGCAGAGCACAGCAGG 0: 1
1: 0
2: 2
3: 30
4: 233
1015983567_1015983572 15 Left 1015983567 6:138863514-138863536 CCAAACGGTAGCACATTTGGCTC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1015983572 6:138863552-138863574 TGGCCTAGCAGAGCACAGCAGGG 0: 1
1: 0
2: 3
3: 22
4: 224
1015983567_1015983570 -5 Left 1015983567 6:138863514-138863536 CCAAACGGTAGCACATTTGGCTC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1015983570 6:138863532-138863554 GGCTCTGCGGAGAGAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015983567 Original CRISPR GAGCCAAATGTGCTACCGTT TGG (reversed) Intronic
903660068 1:24971576-24971598 GAGCCAAAAGGGCTGTCGTTTGG - Intergenic
909241775 1:73222482-73222504 GAGACAAATGTGCAAAAGTTTGG - Intergenic
912061202 1:105673092-105673114 GGGCCAAATATGGTACCTTTGGG - Intergenic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
921882499 1:220271316-220271338 AAGCCAAATGTGCTTCAGGTTGG + Intronic
922190263 1:223312684-223312706 CAGTCAAATCTGCTACCCTTGGG - Intronic
1066377432 10:34870044-34870066 GAGCACAATGTGCTATGGTTTGG - Intergenic
1071496312 10:86169841-86169863 GAGCCACATGGGCTGCCGCTGGG - Intronic
1072603906 10:96961236-96961258 GAGCTAATTCTGCAACCGTTTGG + Intronic
1078600977 11:12730443-12730465 GAGCCAAATGGAATACCGTTAGG - Intronic
1083996834 11:66277052-66277074 GAGCCAGATGTGCTACCTTGGGG - Exonic
1084601930 11:70150936-70150958 CAGCCAAATGTGCCAGCTTTGGG + Intronic
1085371453 11:76010474-76010496 GAGCCAACTATGCTACAGCTGGG + Intronic
1086148956 11:83587546-83587568 TAGGCAAATGTGCTACTTTTAGG + Intronic
1094450909 12:30582358-30582380 GAGCCACATGAGATATCGTTTGG + Intergenic
1102752385 12:115306743-115306765 GAACAAAAGGTGCTACCGGTGGG + Intergenic
1105565929 13:21548053-21548075 TAGACAAATGTTCTACCATTAGG + Intronic
1113440504 13:110324568-110324590 GAGTCAAACGTGCATCCGTTCGG - Intronic
1132248141 15:100313500-100313522 GGGCCAAATCTGAGACCGTTTGG + Intronic
1135334512 16:21589606-21589628 GAGCCAAATTTGCTACTTTTTGG - Intergenic
1140639634 16:76957215-76957237 GAGCCAAATGTGCAACTTGTAGG + Intergenic
1154083042 18:11276733-11276755 GAGGCACATGTGCTAACTTTAGG + Intergenic
1156264009 18:35469523-35469545 GAGCAAAATGGGCTGCAGTTGGG - Intronic
1164561487 19:29295321-29295343 GGGCCAAAAGTTCTACCCTTGGG + Intergenic
926390775 2:12390314-12390336 GAGCTCGATGTGCTAGCGTTTGG + Intergenic
930191165 2:48461750-48461772 GTGCCAAATTTGCAACCTTTAGG + Intronic
939722274 2:145668638-145668660 GAGCCTAATGTGAGACCTTTGGG + Intergenic
940970203 2:159888021-159888043 AAGCCAAATGAGCTAGTGTTTGG - Intronic
950116345 3:10452583-10452605 GAGGCAAATGGGCTACAATTGGG + Intronic
950441145 3:13011267-13011289 GAGCCAAATGGGAAACGGTTTGG - Intronic
956457034 3:69431837-69431859 GAGTAAAATGTGCAACAGTTAGG - Intronic
963908111 3:150790990-150791012 GAGCCAGATGTGCTTCAGTGAGG + Intergenic
967001911 3:185343911-185343933 GAGCCAAAGGTGCTATTTTTAGG + Intronic
974977251 4:68906271-68906293 CTGCCAAATGTGCTACAGATAGG - Intergenic
988479032 5:31613991-31614013 CAGCCAACTGAGCTACCCTTTGG + Intergenic
998297009 5:140980693-140980715 AAGCCAAATGTGCTCCTATTCGG + Intronic
1003039839 6:2677652-2677674 CAGCCAAGTGTGCGGCCGTTGGG + Intronic
1011709792 6:90041220-90041242 GAGTCAAATTAGCTACCATTTGG - Intronic
1015983567 6:138863514-138863536 GAGCCAAATGTGCTACCGTTTGG - Intronic
1017395895 6:153999766-153999788 GAGCCAACTGTGCTTCCACTAGG - Intergenic
1022820791 7:33958766-33958788 GAGTTAGATGTGCTACCTTTGGG + Intronic
1023163307 7:37319231-37319253 GAGGGATGTGTGCTACCGTTGGG - Intronic
1043290244 8:78590205-78590227 TAATTAAATGTGCTACCGTTTGG + Intronic
1043888928 8:85634622-85634644 GAGTCAACTGTGCTACCAGTGGG + Intergenic
1047179776 8:122576063-122576085 GAGCCAACTGTGTGACTGTTTGG + Intergenic