ID: 1015983573

View in Genome Browser
Species Human (GRCh38)
Location 6:138863555-138863577
Sequence ATACCCTGCTGTGCTCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015983573_1015983576 0 Left 1015983573 6:138863555-138863577 CCTAGCAGAGCACAGCAGGGTAT 0: 1
1: 0
2: 5
3: 19
4: 193
Right 1015983576 6:138863578-138863600 GAACGCTGTTGCTGGTAATAGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1015983573_1015983574 -8 Left 1015983573 6:138863555-138863577 CCTAGCAGAGCACAGCAGGGTAT 0: 1
1: 0
2: 5
3: 19
4: 193
Right 1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 75
1015983573_1015983577 6 Left 1015983573 6:138863555-138863577 CCTAGCAGAGCACAGCAGGGTAT 0: 1
1: 0
2: 5
3: 19
4: 193
Right 1015983577 6:138863584-138863606 TGTTGCTGGTAATAGGGAACAGG 0: 1
1: 0
2: 0
3: 7
4: 122
1015983573_1015983575 -1 Left 1015983573 6:138863555-138863577 CCTAGCAGAGCACAGCAGGGTAT 0: 1
1: 0
2: 5
3: 19
4: 193
Right 1015983575 6:138863577-138863599 TGAACGCTGTTGCTGGTAATAGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015983573 Original CRISPR ATACCCTGCTGTGCTCTGCT AGG (reversed) Intronic
900462924 1:2810003-2810025 ATGCCGTGCTGTGGCCTGCTGGG - Intergenic
900849042 1:5127629-5127651 ATTCCCTCCTGTGGTCTGGTTGG + Intergenic
901172326 1:7268157-7268179 CTACACTGCTGTACTCTGCCTGG - Intronic
901794355 1:11671880-11671902 ATACCTGGGTGTGCTCTGCATGG - Intronic
901951170 1:12748083-12748105 AGACTATGCTGTGCTGTGCTGGG - Intronic
903454892 1:23480708-23480730 TGACTCTGCTGTGCTCTGCCTGG - Intronic
905207758 1:36352637-36352659 TTGCCCTGCTATGCTCTGCAGGG - Intronic
906680880 1:47724965-47724987 TTACCCTCCTGGGCTCTGGTGGG - Intergenic
907494951 1:54837516-54837538 GTACCCTGCTGTGCAGTGCTGGG - Intronic
909717702 1:78729030-78729052 TGAGCCTGCTCTGCTCTGCTTGG + Intergenic
910365032 1:86455836-86455858 CTACCCTCCTTTTCTCTGCTTGG - Exonic
910649367 1:89548843-89548865 ATACCCTTCAGGGCTCTGCAGGG + Intronic
911760249 1:101605722-101605744 AAGCCCTGCTGTGCTGTTCTGGG + Intergenic
912512105 1:110196453-110196475 GTCCCCTCCTGTGCTCTCCTAGG - Intronic
913080451 1:115380228-115380250 CCACCCTGGTCTGCTCTGCTGGG + Intergenic
913248819 1:116894054-116894076 AGAGCCTGCTGTGCTCTGCTTGG - Intergenic
914755949 1:150561687-150561709 ATTCCCGGCCGTGCTCAGCTGGG - Intergenic
915095068 1:153456811-153456833 AGACCCACCAGTGCTCTGCTAGG + Intergenic
915482904 1:156199419-156199441 ATAGCATCCTGAGCTCTGCTTGG + Intronic
917237830 1:172913570-172913592 GAACCATGCTGTTCTCTGCTTGG + Intergenic
918625415 1:186651513-186651535 ACACTCTGCTGTGTGCTGCTGGG + Intergenic
920316367 1:205078205-205078227 ATGCCTGCCTGTGCTCTGCTTGG - Exonic
920643375 1:207776173-207776195 ATACCCTCCTGTGCATGGCTTGG - Intronic
921075630 1:211698419-211698441 ATACCCTGCAGTTCTCAACTTGG + Intergenic
921265817 1:213419863-213419885 AGACCCTGCTGTGCTGTGCAGGG - Intergenic
921362324 1:214341410-214341432 ATACCCTCATGTGCTCACCTAGG - Intergenic
921908678 1:220524601-220524623 ATGCCATGCTGTGCTGTTCTAGG - Intergenic
923042848 1:230332238-230332260 GTTCCCAGCTGTGCTGTGCTTGG - Intronic
924547672 1:245045379-245045401 ATACTTTGCTTTGCTTTGCTGGG - Intronic
1062913612 10:1230663-1230685 AGTTCCTGCTGTTCTCTGCTTGG - Intronic
1065095878 10:22280238-22280260 GTCCCCCGCTGTGCTCTGCCTGG + Intergenic
1065855727 10:29828534-29828556 ATGCCATTCTGTGCTCTGCAAGG + Intergenic
1067507827 10:46871666-46871688 TCACCTTGCTGTGTTCTGCTTGG + Intergenic
1067654424 10:48180179-48180201 TCACCTTGCTGTGTTCTGCTTGG - Intronic
1069709830 10:70481098-70481120 ATCCCCGTCTGTGCTCTGCTGGG - Intronic
1070649524 10:78224876-78224898 ATACCAGGCTCTGCTCTGCAGGG + Intergenic
1071502653 10:86214554-86214576 TTGCTCTGCTGTGCTGTGCTGGG - Intronic
1072626385 10:97115068-97115090 AGACCCTTTTGTGCTCTGCCAGG - Intronic
1074880808 10:117656113-117656135 AGAAACTGCTGTGCTCTCCTTGG + Intergenic
1075539710 10:123301846-123301868 AGACCCCTCTCTGCTCTGCTTGG - Intergenic
1076322604 10:129594604-129594626 ATACACTGCTGTGGTATGTTAGG - Intronic
1076504554 10:130963205-130963227 GGACCCTGCTGGGCCCTGCTGGG - Intergenic
1078044919 11:7904960-7904982 ATAACCTGCTGTGCATTGTTAGG + Intergenic
1078095934 11:8297259-8297281 AGACCCTCCTGTGCTGGGCTTGG - Intergenic
1078189347 11:9078614-9078636 ATAACCTGCTGAGGTCTACTTGG - Intronic
1078366095 11:10707737-10707759 CTTGCCTGCTGGGCTCTGCTTGG + Intergenic
1081619442 11:44610565-44610587 TGACCCTGCTGTCCTCTGCATGG - Intronic
1085759160 11:79226980-79227002 CTGCTCTGCTGTGCTCTGCAGGG + Intronic
1086744553 11:90409107-90409129 ATCCCCTTCTATGCTCTGATGGG + Intergenic
1090403214 11:126462057-126462079 ACACCTTGCTGAGCTCTTCTTGG + Intronic
1090407053 11:126482694-126482716 TTTCCCTGCTTTGCCCTGCTGGG + Intronic
1091881463 12:3981926-3981948 AGAGACTGCTGGGCTCTGCTTGG - Intergenic
1091931166 12:4396508-4396530 CTAGCCTGGTGAGCTCTGCTGGG + Intergenic
1092242392 12:6843295-6843317 CTACCCTCCTGTGCCCAGCTGGG + Intronic
1092449673 12:8590312-8590334 ATGCTCTGATGAGCTCTGCTAGG - Intergenic
1096030550 12:48410236-48410258 ATTCCCTCCTGTGCTTGGCTGGG - Intergenic
1096470704 12:51873811-51873833 ATTCTCTGCCCTGCTCTGCTGGG + Intergenic
1097691065 12:62735114-62735136 ATACCCTGCTGTGAAATGTTTGG + Intronic
1099747038 12:86718609-86718631 CTACCCATCTGTGGTCTGCTAGG + Intronic
1101062819 12:100989473-100989495 ATACCCTTCTGCACTGTGCTAGG - Intronic
1101965036 12:109276694-109276716 ATATCCTGGAGTGCTCAGCTGGG - Intergenic
1110607819 13:77453577-77453599 ACACCCTGCTATGCTCAGATGGG + Intergenic
1111932613 13:94526964-94526986 ATACCCTCCTGTGCCTGGCTCGG + Intergenic
1115350132 14:32384979-32385001 ATTCCATGCTTTGATCTGCTTGG + Intronic
1115502493 14:34061682-34061704 ACAGCCTGCTCTGCTGTGCTTGG - Intronic
1117834281 14:59786031-59786053 ATACCCTCCTGTTTTCTGATTGG - Intronic
1118328121 14:64795289-64795311 ATGCCCTGCAGTGCTCACCTTGG - Intronic
1123540298 15:21283020-21283042 ACTCCCTGCTGTGCGCTTCTTGG - Intergenic
1124613615 15:31225719-31225741 GTTGCCTGCTGTGCCCTGCTGGG + Intergenic
1125219853 15:37320278-37320300 ATACCCTCCTGTGCTTTGCTCGG + Intergenic
1127570603 15:60237487-60237509 ATACCCTCCTGTGCCTGGCTCGG + Intergenic
1128349317 15:66878330-66878352 AGTCCCTGCTGTCCTCTGCTTGG - Intergenic
1129201943 15:74008082-74008104 TTACCCTGCTGGGATCAGCTGGG + Intronic
1131132642 15:89909987-89910009 AGACACTGCTGGGCTCTCCTGGG + Intronic
1131198648 15:90377941-90377963 ATACCCTGCTTCTCTCTGATAGG - Intergenic
1202948610 15_KI270727v1_random:10170-10192 ACTCCCTGCTGTGCGCTTCTTGG - Intergenic
1134156107 16:11844603-11844625 GTACCCTGCTCTGCTCTACCTGG + Intronic
1137708610 16:50551312-50551334 ATCCCATGCTGTCCTCAGCTGGG - Intronic
1139717503 16:68825322-68825344 AGCCTCTGCTGTGCTTTGCTAGG - Intronic
1141998444 16:87649279-87649301 ATGCCCTGTGGTGCACTGCTAGG - Intronic
1142961555 17:3555071-3555093 ACACCCTGCTGGGCTCTCCTAGG - Intronic
1144400892 17:14900126-14900148 ATTCCCTGCTGTGAGATGCTTGG + Intergenic
1145762487 17:27433764-27433786 GGACCCTGCACTGCTCTGCTTGG - Intergenic
1148765108 17:50034249-50034271 ATACCTTGCTGGGCTCTCTTGGG + Intergenic
1148800338 17:50221110-50221132 AGACCCTGCCCTGCTCTGCTTGG + Intergenic
1149755574 17:59182792-59182814 GTACCCTGAGGTGCTCAGCTGGG + Intronic
1151163633 17:72186138-72186160 ATACCTTGTTGTGCTCTGGTGGG - Intergenic
1151674986 17:75592658-75592680 CACCCCTGCTGTGCTCTGCAGGG + Intergenic
1154268543 18:12899549-12899571 TTACGCTGCTGTGACCTGCTAGG + Intronic
1156382716 18:36578578-36578600 TCACAGTGCTGTGCTCTGCTGGG + Intronic
1157173136 18:45426479-45426501 ATACAAGGGTGTGCTCTGCTTGG - Intronic
1157694342 18:49708868-49708890 GCACCCTGCCGAGCTCTGCTGGG + Intergenic
1163420820 19:17212771-17212793 AGACCCTGCTGTGGTTGGCTTGG + Exonic
1165717847 19:38058137-38058159 CCAGCCTGCTGTGCTCTGCCTGG + Intronic
1165860061 19:38904558-38904580 ACAACCTGATGCGCTCTGCTTGG + Intronic
926914021 2:17876650-17876672 TTACCCTGCTGAGCCCTGCAGGG - Intergenic
930599742 2:53429245-53429267 GGACCCTGCTGTGCTCAGTTGGG - Intergenic
933260216 2:80123958-80123980 AGCCCCTGCTGGGCTGTGCTGGG - Intronic
939441892 2:142260658-142260680 GTGCTGTGCTGTGCTCTGCTGGG + Intergenic
940860261 2:158763961-158763983 AGACCCTGCTGTGCAGGGCTAGG - Intergenic
943321366 2:186447326-186447348 GGAAACTGCTGTGCTCTGCTGGG - Intergenic
947440603 2:230117918-230117940 ATACCCTCCTGTGCCTGGCTCGG - Intergenic
947462808 2:230317843-230317865 ACACCCTGCTCTGCTGAGCTGGG + Intergenic
948424644 2:237879270-237879292 TTACCCTGCTGTCTTCTGCCAGG - Intronic
948800601 2:240431753-240431775 GGAGCCTGCTCTGCTCTGCTGGG - Intergenic
1170391641 20:15881277-15881299 ATAAACTTCTGTCCTCTGCTTGG - Intronic
1170804831 20:19620397-19620419 ATATTCTGCAGTGCTCTGCAAGG + Intronic
1171255755 20:23688125-23688147 AACCCCTCCTCTGCTCTGCTGGG + Intronic
1171299029 20:24043197-24043219 CCAACCTGCTGTGCTCTGGTGGG + Intergenic
1172657702 20:36547030-36547052 ATACCCTGCTGTGTCCCCCTGGG - Intronic
1172787453 20:37478538-37478560 ATAGACTGCTCTGCTCTGCCTGG - Intergenic
1173337030 20:42120616-42120638 AGGCCCTGCTGTACTCTGGTTGG + Intronic
1174659004 20:52194343-52194365 GTAAGCTGCGGTGCTCTGCTGGG - Intronic
1175304953 20:57969499-57969521 CTGCCCTGCTGTGCCCTGCAGGG + Intergenic
1179115049 21:38483234-38483256 ATACCGTGCTGTGCTGTACTTGG + Intronic
1179494813 21:41764859-41764881 TTCACCTCCTGTGCTCTGCTGGG - Intronic
1179668246 21:42927290-42927312 AGAGCGTTCTGTGCTCTGCTAGG - Intergenic
1180698452 22:17769141-17769163 AGGCCCTGCTGTGCTCTGTGAGG - Intronic
1181346884 22:22225823-22225845 ATCTCCTGCTGTGTTGTGCTGGG + Intergenic
1183834108 22:40437843-40437865 AACCCTTGCTGTGCTCTGATGGG - Intronic
1184979033 22:48082941-48082963 TTCCCCTGCAATGCTCTGCTGGG - Intergenic
1185009312 22:48304404-48304426 ATACCCTGAGGTGCCGTGCTGGG - Intergenic
1185044707 22:48523164-48523186 AAACCCTGCTGCGCCCTGCACGG + Intronic
949243716 3:1900834-1900856 TGACCCTGCTGTCCTCTGTTGGG - Intergenic
949543885 3:5055518-5055540 ATACCCTGTTGTGTCCTGCAGGG + Intergenic
950709108 3:14802514-14802536 GTGCCCTGCTGTGCCCAGCTAGG - Intergenic
953885111 3:46710576-46710598 AGGCCCTGCTGTGATCTTCTAGG - Exonic
954397238 3:50299245-50299267 ATACCCAGCTGTGCGGAGCTAGG - Exonic
954565023 3:51592443-51592465 ATGTCCTGCTGTGCTCTGCTAGG + Intronic
960246659 3:115407377-115407399 ATACACTGCTCTGCTATTCTTGG + Intergenic
961918728 3:130404019-130404041 ATAACCTGCTGTGCCCTGCTTGG - Intronic
964717777 3:159740904-159740926 AGACCCTGATGTGCTCTGAGTGG + Intronic
966253276 3:177890859-177890881 AGACCCTGCTGTGTTCTTCTGGG + Intergenic
967726819 3:192869850-192869872 ATAACCTGCTGAGCTGAGCTAGG + Intronic
970886946 4:20997349-20997371 ATACGCTACCATGCTCTGCTGGG - Intronic
971343135 4:25788903-25788925 ATGACCTGCTGAGCTCTGCTGGG - Intronic
972822478 4:42717274-42717296 ATACCCTGCTTTGCCATGCAGGG - Intergenic
973119135 4:46496722-46496744 TTACCTTGCTGTGCTCCCCTTGG - Intergenic
976477923 4:85506371-85506393 ATACCTTGCTGAGCTGTGGTGGG + Intronic
977033942 4:91925123-91925145 GTACCATCCTCTGCTCTGCTCGG - Intergenic
977222541 4:94354846-94354868 CTACCCTTCTGTGCTCAGCTGGG - Intergenic
979370742 4:119882805-119882827 ATACTCTGCTGTGCTCAACAGGG - Intergenic
979972981 4:127160571-127160593 ATACTCTGCTTTGTGCTGCTGGG + Intergenic
981943365 4:150311512-150311534 ATACTCTCCAGTGCTGTGCTGGG + Intronic
982436658 4:155388341-155388363 GGACCCTGCACTGCTCTGCTTGG - Intergenic
984924449 4:184794494-184794516 CTGCCCTTCTGTGCTCAGCTGGG - Intronic
988506278 5:31826199-31826221 ATGCCCGGCTGTGGGCTGCTAGG + Intronic
990110740 5:52320248-52320270 ATACCCTGCTGGAGTCTGCAGGG - Intergenic
991240805 5:64458080-64458102 CTATCCTGCTTTGCTCTGCCTGG - Intergenic
992333030 5:75737230-75737252 AGACTCTGATGTGCCCTGCTTGG - Intergenic
995187754 5:109289836-109289858 CTGCTCTGCTGTGCTGTGCTGGG - Intergenic
997235672 5:132270824-132270846 CCACCCTGCTGTGCTGTGCCAGG - Intronic
1000172715 5:158718825-158718847 ATATACTTCTGTGCTGTGCTGGG - Intronic
1000876837 5:166650003-166650025 AAACTCTTCTGTGCTCTGATGGG + Intergenic
1001315924 5:170641319-170641341 CTACCTGGCTCTGCTCTGCTGGG + Intronic
1002040337 5:176508882-176508904 ATACCCTCCTGTGTGCTGCCAGG - Exonic
1003147484 6:3520879-3520901 AGACCCTGCTGTGCTGGGCTGGG + Intergenic
1004180684 6:13378348-13378370 ATACAATGCTGGGGTCTGCTGGG - Intronic
1005455833 6:26018900-26018922 ACTCTCTGCTGTGCTGTGCTAGG - Intergenic
1007094737 6:39206226-39206248 ATTCCCTGCTGTGCTTTGGTTGG - Intronic
1007164707 6:39821221-39821243 ATACCTTGCTGGGCTGTGGTTGG + Intronic
1007638006 6:43311905-43311927 CTGCAGTGCTGTGCTCTGCTAGG + Intronic
1008427445 6:51376007-51376029 ACAGCCAGCTGTGTTCTGCTGGG + Intergenic
1008781101 6:55106372-55106394 AGATCTTGCTGTGCTCTGATAGG - Intergenic
1010150557 6:72727152-72727174 AGACCCTGCTGTGCTATGTGGGG - Intronic
1011031903 6:82932452-82932474 ACTCCATGCTGTGATCTGCTTGG + Intronic
1015223066 6:130826683-130826705 ATACTCTCCTCTGCTCTACTGGG - Intergenic
1015983573 6:138863555-138863577 ATACCCTGCTGTGCTCTGCTAGG - Intronic
1019910355 7:4096755-4096777 CTGCCCTGCTGGCCTCTGCTTGG - Intronic
1020834048 7:13126647-13126669 ATACCCTCCTGTGCCTGGCTCGG - Intergenic
1021554717 7:21907782-21907804 TTCCCCTGCTTTACTCTGCTGGG + Intronic
1024243943 7:47455352-47455374 AAGCCCTGCTGTGCCCTTCTGGG - Intronic
1024262639 7:47583371-47583393 AACCCCTGCTGTGCTCTGGAAGG + Intergenic
1024348813 7:48341360-48341382 ATTCTCTGCTCTGCTCTCCTGGG + Intronic
1024389677 7:48793904-48793926 ATACCCTGCTTTGTGATGCTGGG - Intergenic
1026748046 7:73027880-73027902 GTACCCTGAGGTGCTCCGCTGGG + Intergenic
1026751694 7:73056025-73056047 GTACCCTGAGGTGCTCCGCTGGG + Intergenic
1026755343 7:73084152-73084174 GTACCCTGAGGTGCTCCGCTGGG + Intergenic
1026758993 7:73112166-73112188 GTACCCTGAGGTGCTCCGCTGGG + Intergenic
1027034250 7:74913194-74913216 GTACCCTGAGGTGCTCCGCTGGG + Intergenic
1027088414 7:75281307-75281329 GTACCCTGAGGTGCTCCGCTGGG - Intergenic
1027092057 7:75309235-75309257 GTACCCTGAGGTGCTCCGCTGGG - Intergenic
1027095700 7:75337202-75337224 GTACCCTGAGGTGCTCCGCTGGG - Intergenic
1027323641 7:77030484-77030506 GTACCCTGAGGTGCTCCGCTGGG + Intergenic
1029395801 7:100307926-100307948 GTACCCTGAGGTGCTCCGCTGGG - Exonic
1033660595 7:143399334-143399356 AGACTCAGCAGTGCTCTGCTGGG + Exonic
1033958378 7:146880695-146880717 AAACTCTGCTGTGCTGTGCTTGG + Intronic
1034472509 7:151262934-151262956 TTAGCCTGCTGGGCTCTGCAGGG - Intronic
1034758268 7:153644289-153644311 CAAGCCTGCTGTGCTCTGCCAGG + Intergenic
1034891823 7:154846426-154846448 CAGCCCGGCTGTGCTCTGCTGGG - Intronic
1037492863 8:19412219-19412241 ATGCCCTGCAGTGCTCTGCTGGG - Intronic
1039355526 8:36811367-36811389 AGACCCTGTTTTGTTCTGCTTGG - Intronic
1042691428 8:71503817-71503839 AGACCCTGCTGTGGTCTGTGGGG - Intronic
1045570107 8:103360018-103360040 ATACCCTGCTCTGAAATGCTAGG + Intergenic
1047555599 8:125926101-125926123 CAACACTGCTGTGCTCTCCTTGG + Intergenic
1048384579 8:133899716-133899738 CAAACCTGCTGTGCTCTGCTTGG - Intergenic
1049321313 8:141998309-141998331 CTGCTGTGCTGTGCTCTGCTGGG - Intergenic
1049321315 8:141998334-141998356 GCTCTCTGCTGTGCTCTGCTGGG - Intergenic
1050964957 9:11788235-11788257 AGGCCCTGGTGTGCTGTGCTGGG + Intergenic
1056417418 9:86390282-86390304 ATACCCTCCTGTGCCTGGCTTGG + Intergenic
1057477343 9:95414019-95414041 GTACCCTACAGTGCTCGGCTGGG - Intergenic
1058993192 9:110274564-110274586 ATACCTTCCTGTCTTCTGCTTGG - Intergenic
1059395868 9:114033677-114033699 ACAGCTTGCTGTGCCCTGCTCGG - Intronic
1060018825 9:120110873-120110895 ATAGCCTGCAGGTCTCTGCTTGG + Intergenic
1060115379 9:120936256-120936278 AGCACCTTCTGTGCTCTGCTGGG - Intergenic
1060771792 9:126337261-126337283 ATTCCCTCCTGTGCGGTGCTTGG + Intronic
1060904627 9:127293961-127293983 CTCCCCTGCTCAGCTCTGCTCGG + Intronic
1062383278 9:136298018-136298040 GTCCCCTGCAGTGCTCTGCCTGG + Intronic
1062596957 9:137303823-137303845 CTGGCCTGCCGTGCTCTGCTGGG + Intergenic
1187122035 X:16418869-16418891 ATTCACTGCTGTGCTCTCCTGGG - Intergenic
1192034444 X:67546866-67546888 TTACCCTGCTGAGCTCTCCCAGG - Intronic
1192997482 X:76527667-76527689 ATACCCTGCTGTGCCTGGCTCGG - Intergenic
1195990482 X:110677344-110677366 ATAATGTGCTGGGCTCTGCTAGG + Intronic
1198220764 X:134599636-134599658 ATAAACTGTTGGGCTCTGCTGGG - Intronic
1198648750 X:138837992-138838014 ATAAGCAGCTGTGCTGTGCTGGG + Intronic
1199602692 X:149551998-149552020 ATAGTCAGCTGTGCTCTGCTTGG - Intergenic
1199647696 X:149927477-149927499 ATAGTCAGCTGTGCTCTGCTTGG + Intergenic
1200164925 X:154029517-154029539 TCACCCCGCTGTGCTCTGCCCGG + Intronic