ID: 1015983574

View in Genome Browser
Species Human (GRCh38)
Location 6:138863570-138863592
Sequence CAGGGTATGAACGCTGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015983573_1015983574 -8 Left 1015983573 6:138863555-138863577 CCTAGCAGAGCACAGCAGGGTAT 0: 1
1: 0
2: 5
3: 19
4: 193
Right 1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015983574 Original CRISPR CAGGGTATGAACGCTGTTGC TGG Intronic
904454099 1:30636563-30636585 CAAGGTATGAGGGCTGCTGCAGG + Intergenic
909089915 1:71212620-71212642 CAGGGTTTGAACTCTGGTGAAGG + Intergenic
912381822 1:109251661-109251683 CAGGCTATCGACGCTGATGCTGG + Exonic
915970940 1:160354682-160354704 CAGAGTATGAATACTGTTTCTGG - Intronic
919429139 1:197471304-197471326 CAGGGTTTGAAGTCTCTTGCTGG - Intronic
921919855 1:220655640-220655662 CAGAGTATGAAGGCAGTGGCGGG - Intronic
922167897 1:223130929-223130951 CAGGGCATCAATGCTGTTGGTGG + Intronic
1064297599 10:14092435-14092457 CTGGGAATGGACTCTGTTGCTGG + Intronic
1067693456 10:48519277-48519299 CTGGGCAGGAATGCTGTTGCTGG - Intronic
1074003116 10:109392239-109392261 CAGGGTAAGGACGCTGGTGCTGG + Intergenic
1074649335 10:115501380-115501402 CAGGTTATGAACCCTGTTACAGG + Intronic
1086251034 11:84814559-84814581 CAGAGTATGAAGGCTGTGGAGGG - Intronic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089797959 11:120998554-120998576 CAGGAGAAGAATGCTGTTGCAGG + Intergenic
1092912784 12:13162817-13162839 CAGGTTATAAATTCTGTTGCTGG + Intergenic
1104395427 12:128428281-128428303 CAGGGCATGAATGATGTTCCTGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112302991 13:98247310-98247332 CAGGGTGTGTACTCTGTTGGTGG + Intronic
1113725131 13:112592786-112592808 CCGTGTCTGAAGGCTGTTGCGGG - Intergenic
1119332087 14:73802520-73802542 TAGGGTATGAGCCCTGTTTCCGG + Intergenic
1125422646 15:39519914-39519936 CTGGGTAGGAACGCTGCTGCTGG - Intergenic
1129457795 15:75684945-75684967 CAGGGCATGAAGGGTGCTGCTGG - Intronic
1132426200 15:101719510-101719532 CATGGTATGAATGCTTTAGCTGG + Intronic
1132474762 16:128914-128936 AAGGGTATGAACCCTGTATCTGG + Intronic
1132502883 16:292448-292470 AAGGGTCTGAACCCTGATGCTGG + Intronic
1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG + Intronic
1136281201 16:29212422-29212444 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1142085565 16:88178345-88178367 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1149852196 17:60044551-60044573 CAGTGTCTGGATGCTGTTGCAGG - Intronic
1154383903 18:13876246-13876268 GAGGGTTTGAGAGCTGTTGCAGG + Intergenic
1159449603 18:68583534-68583556 CAGGGTATGAAGGCTTTTGGTGG - Intergenic
1159460944 18:68722138-68722160 CTGGCTTTGAACGCTGTTGAGGG + Intronic
1163383795 19:16986459-16986481 CAGGGTGGGGACGCTGGTGCTGG - Intronic
1167904651 19:52648994-52649016 CAGGGCATGAAAACTGTCGCTGG - Intronic
926822619 2:16869865-16869887 CAGAGTGTGAATGCTCTTGCTGG - Intergenic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
943608512 2:190004839-190004861 AAGGTTATGAACACTGTTGTAGG + Intronic
948176911 2:235950571-235950593 CAGGGGATGAAGGCTGCTGTAGG + Intronic
948553026 2:238787353-238787375 GCGTGTATGAATGCTGTTGCTGG - Intergenic
1174196703 20:48777336-48777358 GAGGGTATGAAGGCTTTCGCTGG + Intronic
1176294343 21:5063149-5063171 CAGGGTTGGACCGCAGTTGCTGG - Intergenic
1177367165 21:20153345-20153367 CAGGCTATGAAAGCAGCTGCAGG - Intergenic
1178624084 21:34201253-34201275 GAGTGAATGAACGCTGTTCCCGG - Intergenic
1179862710 21:44198977-44198999 CAGGGTTGGACCGCAGTTGCTGG + Intergenic
949247220 3:1939483-1939505 CAGGGTATGATGGCTGGGGCTGG - Intergenic
951077281 3:18410705-18410727 CAGTATATGAACACTGATGCTGG + Intronic
951104820 3:18730511-18730533 CTGGGTATAAATGATGTTGCTGG - Intergenic
953635864 3:44663636-44663658 CAGGCTAAGAGCTCTGTTGCAGG + Intergenic
956837481 3:73107317-73107339 CAGGATATGAACCCAGATGCTGG + Intergenic
968798317 4:2724570-2724592 CAAGGTGTGAACGCTGTGCCTGG - Intronic
970503164 4:16699363-16699385 CAGGGAATGAAGTCTGTAGCAGG - Intronic
972417445 4:38855716-38855738 CAGGGTATGAACGCCTCTGGAGG - Intronic
973084259 4:46035186-46035208 CAGGGGATGACTGCTGTTTCTGG - Intergenic
976598296 4:86914751-86914773 CTGGGTATGATCCCTGTTCCAGG + Intronic
978402756 4:108348420-108348442 CAGGGTTTAAACTCAGTTGCAGG + Intergenic
980429872 4:132680323-132680345 CAGGGTATGAAGACTGATTCTGG + Intergenic
981718840 4:147778815-147778837 CAGGGAATGAATTCTGTTGGAGG + Intronic
982577121 4:157127393-157127415 CAGGGTTTGCACTCTGTTGTTGG + Intronic
986152678 5:5141329-5141351 CAGGATATGAACGTTGCTGATGG - Intronic
991425511 5:66487909-66487931 CAGAGTATAAATCCTGTTGCTGG - Intergenic
993486889 5:88497779-88497801 CTGGGTATGAGTGCTGATGCAGG - Intergenic
994447161 5:99891006-99891028 CAGGGTGAGCATGCTGTTGCAGG - Intergenic
1002285938 5:178162756-178162778 CAGGATCTGAACGCTGCTCCCGG + Intergenic
1004132482 6:12933815-12933837 CAGGGTATGAGCCCTGTTCAAGG + Intronic
1004857050 6:19761930-19761952 CAGGGGATGAATCCTGTTTCAGG - Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1017293656 6:152769993-152770015 CAGGGTATTAAAGCAGTAGCTGG + Intergenic
1026899769 7:74030327-74030349 CAAGGAAGGAACCCTGTTGCGGG + Intronic
1028585723 7:92449019-92449041 AAGGGAATGAGCTCTGTTGCAGG + Intronic
1030673487 7:112362455-112362477 CAGGGAATGAAAGCTGATGAAGG - Intergenic
1032059774 7:128714942-128714964 CAGGTTATGGAAGCAGTTGCAGG - Intronic
1036477322 8:9104943-9104965 CAGAGTATGAAAGCTTTAGCAGG + Intronic
1041895864 8:62924154-62924176 CTGGGTATGAAAGCTCTTGGTGG - Intronic
1042976522 8:74476553-74476575 CAGGATATGAAAGCTGTGGTTGG + Intronic
1043812960 8:84765396-84765418 CAGGGTATCACCTCTTTTGCTGG + Intronic
1048986692 8:139738614-139738636 CAGAGTCTGATCGGTGTTGCGGG - Intronic
1058814381 9:108669858-108669880 CAAGGTATCAACACTGATGCAGG + Intergenic
1061716593 9:132522113-132522135 CAGGGGATGGGGGCTGTTGCAGG + Intronic