ID: 1015984571

View in Genome Browser
Species Human (GRCh38)
Location 6:138872365-138872387
Sequence GACAGTTCCTGCCTTTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015984569_1015984571 0 Left 1015984569 6:138872342-138872364 CCTGGGACTAGACAGCAAAGTAA 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1015984571 6:138872365-138872387 GACAGTTCCTGCCTTTGTGGAGG 0: 1
1: 0
2: 2
3: 21
4: 200
1015984565_1015984571 25 Left 1015984565 6:138872317-138872339 CCACATGCTAGACCTTCTGCTAA 0: 1
1: 0
2: 3
3: 7
4: 154
Right 1015984571 6:138872365-138872387 GACAGTTCCTGCCTTTGTGGAGG 0: 1
1: 0
2: 2
3: 21
4: 200
1015984568_1015984571 13 Left 1015984568 6:138872329-138872351 CCTTCTGCTAAATCCTGGGACTA 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1015984571 6:138872365-138872387 GACAGTTCCTGCCTTTGTGGAGG 0: 1
1: 0
2: 2
3: 21
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015984571 Original CRISPR GACAGTTCCTGCCTTTGTGG AGG Intronic
901208512 1:7511110-7511132 CACAGTTCCTGCCTTCCAGGAGG - Intronic
901853683 1:12031140-12031162 CACAGGCCCTGCCTTGGTGGGGG + Intronic
902270319 1:15299653-15299675 TATGGTTCCTGCCTTTCTGGTGG - Intronic
902538076 1:17133173-17133195 GACTGGTCCTCCCTTTTTGGGGG + Intergenic
904344111 1:29856923-29856945 GGCTGTTCCTGCCTCTCTGGGGG + Intergenic
905085593 1:35373270-35373292 CAAAGTTCCTACCCTTGTGGGGG - Intronic
907474673 1:54697889-54697911 TAGAGTCCCTGACTTTGTGGTGG - Intronic
909119051 1:71577191-71577213 GAATATTCCTGCCTTTTTGGTGG + Intronic
909329095 1:74391208-74391230 AACAGATCCTGCCTTTATGGAGG + Intronic
915313572 1:155016406-155016428 GGCAGTTCTGGCCTTTGAGGTGG - Exonic
916394389 1:164369782-164369804 GAAAGGTCCTGCGTTTGAGGAGG - Intergenic
917306852 1:173635579-173635601 GAGAGTTTCTGCATTTGTGATGG + Intronic
917401839 1:174658251-174658273 GATATTTCCTGCTATTGTGGAGG + Intronic
917963440 1:180164156-180164178 GACCATACCTGCCTTTGTGCAGG + Intronic
918476593 1:184931760-184931782 GACATTTCCTGCCTTTCTTCTGG - Intronic
919621409 1:199868150-199868172 GACAGTCCCTGCCTCTGTGGAGG + Intergenic
919927847 1:202201700-202201722 TACAGTTCCTGTCTTTCTGGGGG + Intronic
921328525 1:214012184-214012206 GACATTTAGTCCCTTTGTGGAGG + Intronic
922134115 1:222807873-222807895 GACGGTGCCTGCCTATGTTGAGG + Intergenic
922614542 1:226954049-226954071 GACAGTTCCTGGCTGGGAGGGGG + Intronic
923188042 1:231593288-231593310 GAAAGTTCTTGCCTTTGTGAAGG + Intronic
923744148 1:236685463-236685485 GACACTTCCTGCCTTTGGTTTGG + Intergenic
924751375 1:246894937-246894959 GACAGTTTTTGCATTTTTGGCGG - Intronic
924890800 1:248277395-248277417 TACAGACACTGCCTTTGTGGAGG - Intergenic
1063588644 10:7375655-7375677 GACTGTCCCTGCCTGTGGGGTGG - Intronic
1064999405 10:21324044-21324066 GACACTGCATGCCTTTGGGGGGG - Intergenic
1067487942 10:46669433-46669455 TAAAATTCCTGCCCTTGTGGAGG - Intergenic
1067606863 10:47672575-47672597 TAAAATTCCTGCCCTTGTGGAGG + Intergenic
1067691785 10:48506689-48506711 GAGAGTGGCTGCCTTGGTGGGGG - Intronic
1068633600 10:59323719-59323741 GACAGGTCCTGCCCTTGGAGAGG - Intronic
1069511205 10:69043745-69043767 GACAGTTCATGCCTAGATGGCGG - Intergenic
1069593848 10:69657796-69657818 GACACTCCCTGCCTTTGTCTTGG + Intergenic
1069827693 10:71264099-71264121 GATAGTTCCTGCCATTGGGGTGG + Intronic
1071622425 10:87133935-87133957 TAAAATTCCTGCCCTTGTGGAGG + Intronic
1071797610 10:89023085-89023107 GCCAGTAACTGTCTTTGTGGGGG - Intergenic
1072068916 10:91897668-91897690 GATAGTTGCTGCCTTTGAGCTGG - Intergenic
1072508053 10:96090044-96090066 CACAGTTCCTACGATTGTGGGGG + Intergenic
1076379907 10:130017762-130017784 GACAGACCCTGCCTTTCTGGAGG - Intergenic
1076977084 11:181696-181718 GACAGTTCATTCCTTTCTGTTGG - Intronic
1077578104 11:3399572-3399594 GAAAGTTCCAGCCTTCTTGGTGG + Intergenic
1078399107 11:11008697-11008719 CACAGATCCTGCCCTTGAGGAGG + Intergenic
1080290341 11:30664074-30664096 GAGAGTCCCTGCATGTGTGGAGG - Intergenic
1080658788 11:34279129-34279151 GACAGTTCATGCATTTGCTGGGG - Intronic
1080815512 11:35752586-35752608 CACAGTCTCTGCCTTAGTGGGGG + Intronic
1081818866 11:45971277-45971299 GACCATGCCTGCCTCTGTGGTGG - Exonic
1082072063 11:47947179-47947201 GCAGGTTCCTGCCTTTTTGGGGG + Intergenic
1087231748 11:95674027-95674049 GACAGTTTCTACCTTTATGGAGG - Intergenic
1087569146 11:99902096-99902118 GCCAGTTCATGTCATTGTGGTGG - Intronic
1088610455 11:111571471-111571493 GCCTGTTCCTGCCTTTCTCGTGG + Intergenic
1088713380 11:112527831-112527853 GACAGCCCCTGCCTTTGTAACGG + Intergenic
1088971654 11:114779595-114779617 GACAGTTTCTGGCTTTGTTTGGG + Intergenic
1089774293 11:120825613-120825635 GGCAGTCCCTGCCCTTGGGGAGG + Intronic
1092149749 12:6239472-6239494 GTCAGTTCCTGCCTCTGCTGAGG + Intergenic
1096414188 12:51399359-51399381 AACAGTGGCTGCCTTTGGGGAGG - Intronic
1098323053 12:69269351-69269373 AACAGTAGCTGCCTTTGTGGTGG - Intronic
1100340893 12:93678330-93678352 GGCAGTTTCTGCCTTGGTGGTGG + Intronic
1102484083 12:113244340-113244362 GCCAGTTCTTGCCTTTCTGAAGG + Intronic
1102521557 12:113480250-113480272 GACAGCTCCTGTCTTTGTCTTGG - Intergenic
1103008197 12:117438596-117438618 GCCACTGCCTGCCTTGGTGGAGG - Intronic
1103275013 12:119704189-119704211 GCGAGATCCTTCCTTTGTGGAGG - Intronic
1103978070 12:124716794-124716816 CTCAGTTCCTCCCATTGTGGAGG - Intergenic
1104635110 12:130433605-130433627 GCCAGTTCCTGCCTGGGTGGTGG + Intronic
1105373469 13:19821248-19821270 GACAGTTCCTGCAGCTGGGGAGG + Intergenic
1107234917 13:38156502-38156524 CACAGTGCCTGCCTTTCTGTAGG - Intergenic
1107823211 13:44304883-44304905 GAATGTTCCTGCCTTTGGGTAGG - Intergenic
1109718470 13:66246910-66246932 GACTGGTCCTGCCCTTGAGGTGG - Intergenic
1110656715 13:78008486-78008508 GAGAGTCCCAGCCTGTGTGGTGG - Intergenic
1113838134 13:113343012-113343034 ACGAGTTCCTGTCTTTGTGGAGG - Intronic
1120385569 14:83841269-83841291 GCCAGTACCTGCTTTTGGGGGGG - Intergenic
1121939408 14:98055565-98055587 AACAGTTTCTGCTTTTCTGGAGG - Intergenic
1123095573 14:105765580-105765602 GCCAGCTCCTGCCTGGGTGGGGG + Intergenic
1127540124 15:59929273-59929295 GACACTTCCTGCATTTGTGCTGG - Intergenic
1129315416 15:74740155-74740177 GGCAGTTCCTGCCTTCAGGGAGG - Intergenic
1131018495 15:89077718-89077740 AACCCTTCCTCCCTTTGTGGTGG + Intergenic
1134222807 16:12368526-12368548 TACAGTCCCTGCCTTTGAGAAGG + Intronic
1134550134 16:15134989-15135011 GACAGTGGCTGCCTCTGGGGTGG + Intronic
1134718335 16:16368006-16368028 GACAGTGGCTGCCTCTGGGGTGG - Intergenic
1134956417 16:18384153-18384175 GACAGTGGCTGCCTCTGGGGTGG + Intergenic
1140473242 16:75226398-75226420 GAGAGGTCCTGCCCATGTGGTGG + Intergenic
1142314087 16:89332430-89332452 TACAGGTGCTGCCGTTGTGGAGG - Intronic
1142443172 16:90114984-90115006 GACAGTTCATTCCTTTCTGTTGG + Intergenic
1142464221 17:119870-119892 GACAGTTCATTCCTTTCTGTTGG - Intergenic
1143386649 17:6534978-6535000 AACAGTTCCTGCACGTGTGGAGG - Intronic
1146736747 17:35244496-35244518 GGCTGTGCCTGCCTTTGTGGGGG + Intronic
1147677566 17:42218664-42218686 GGCAGCTCCTGCCTGCGTGGGGG - Intronic
1147688473 17:42300907-42300929 GGCAGCTCCTGCCTGCGTGGGGG + Intronic
1148820871 17:50358944-50358966 GACATTTCCTAGCTTTGTGAAGG - Intronic
1151512660 17:74570802-74570824 GATTGGTCCTGCCTTTGTGGAGG - Intergenic
1152459382 17:80433241-80433263 GTCAGTACCTGCCCATGTGGTGG + Intronic
1152791362 17:82282107-82282129 TACAGTCCCAGCCTTCGTGGTGG - Intergenic
1153413495 18:4820182-4820204 GCCAGCTCCTGGTTTTGTGGTGG - Intergenic
1155861539 18:30907141-30907163 GACAAGTCTTGCCTTAGTGGTGG + Intergenic
1156624921 18:38897208-38897230 CACAGTTAATGCCATTGTGGAGG - Intergenic
1156778265 18:40820219-40820241 CACAGTTCCTCCTTTTGGGGTGG + Intergenic
1157816636 18:50734269-50734291 GACAGTTCCTGCCTAGCTTGGGG + Intergenic
1161938476 19:7386907-7386929 GACAGTTCCTGCCTTCCAGCTGG + Intronic
1164986042 19:32649518-32649540 GAGGGACCCTGCCTTTGTGGTGG - Intronic
1165239608 19:34455363-34455385 AAGAGTTCCTACCTTAGTGGTGG + Intronic
1166979180 19:46622644-46622666 GACAGCTCCTGGCTTTCTGGAGG - Intronic
1167715421 19:51140001-51140023 GCCAGTGCCTGCCTTTTTGATGG - Intergenic
925719647 2:6814459-6814481 GCCGGTTCCTGCCACTGTGGGGG - Intergenic
926134984 2:10330263-10330285 GAGAATTCCTGACTTTTTGGTGG + Intronic
929783434 2:44972546-44972568 GACACATCCTGCCTGTGGGGTGG + Intergenic
932622035 2:73270445-73270467 AATAGTTCCAGCCTGTGTGGGGG - Intronic
935535076 2:104284447-104284469 GACGGTTCCTTCCTTTGAGGAGG - Intergenic
936886200 2:117312128-117312150 GACAATTTCTGCCTTTGTATTGG - Intergenic
938078918 2:128358914-128358936 GACAGCTCCTGCCTATGCGGGGG + Intergenic
940110233 2:150144707-150144729 CACAGCCTCTGCCTTTGTGGTGG + Intergenic
940332431 2:152489662-152489684 GACAGTATTTTCCTTTGTGGGGG + Intronic
941709275 2:168694833-168694855 GACAGGAACTGCCTTTGTGCAGG + Intronic
942901871 2:181129759-181129781 GAAATTTCCTGCCTTTGGGTAGG + Intergenic
944025417 2:195160226-195160248 GACAGTGGTTGCCTTTGGGGAGG + Intergenic
947987449 2:234461101-234461123 GCCAGTGCCTGCCTGTGCGGTGG + Intergenic
948130822 2:235599540-235599562 GACAAATCCTGACTTGGTGGGGG - Intronic
948764714 2:240213510-240213532 GACAGTCCCTGCATGTGTTGGGG - Intergenic
1168753964 20:302916-302938 CACAGTCCCTGGCTTTGTAGAGG - Intergenic
1168991582 20:2101189-2101211 GGCAGTTTCTGCCTTGGTTGAGG - Intergenic
1171212101 20:23324991-23325013 GACAGCTCCTACCTTTTGGGTGG + Intergenic
1172884686 20:38223140-38223162 GAAGGAGCCTGCCTTTGTGGGGG - Intronic
1172922224 20:38494193-38494215 CAGAGTTCCTGCCTTTGAGTTGG - Intronic
1173410010 20:42801833-42801855 GACAGTTTCTGCCTTGTGGGGGG + Intronic
1175158615 20:56991400-56991422 GACAGTTCCTGCCCTTCAGAGGG + Intergenic
1175219537 20:57409020-57409042 GACGGTTCCTGCCTGTCTTGGGG + Exonic
1175330941 20:58163396-58163418 GACAGCACCCGCCTTGGTGGGGG + Intergenic
1178944985 21:36939585-36939607 GACAGTTCCTCCCTGTAAGGAGG + Intronic
1179834317 21:44019385-44019407 CTCAGTGCCTGCCTCTGTGGTGG + Intronic
1180037882 21:45259208-45259230 GGCAGTTGCTGCCTCTGTGCCGG + Intergenic
1180079466 21:45480196-45480218 GGCAGTGCCTGCTTTTGAGGAGG - Intronic
1181635537 22:24172694-24172716 CACAGATCCTTCCTTTGGGGAGG + Intronic
1183607817 22:38876757-38876779 GACAGTTGTTGCCTTTTTTGGGG - Intergenic
1183795796 22:40116504-40116526 GACTGTTCCAGCCATTATGGGGG + Intronic
950658968 3:14454765-14454787 GGCAGTTGCTGCCTGTGTGGGGG - Intronic
950809339 3:15636356-15636378 GTCAGTGCCAGCCTTTGTGAAGG + Intronic
951189280 3:19749631-19749653 GACAGCTGCGGCCTCTGTGGGGG + Intergenic
952278052 3:31896707-31896729 GGCAGTGCCTGCCTTAGAGGGGG + Intronic
953481452 3:43255915-43255937 AGCAGCTCCTGCCTTTGTGTGGG + Intergenic
954645543 3:52129474-52129496 GACAGGTCTTGCCTTTGGAGAGG - Intronic
956188431 3:66584466-66584488 GACTGTGCCTGCATTGGTGGAGG - Intergenic
956852473 3:73242797-73242819 GACAGTCTCTGCCTTTATTGGGG - Intergenic
957049283 3:75398872-75398894 GAAAGTTCCAGCCTTCTTGGTGG + Intergenic
959595198 3:108122077-108122099 GAAAGCTCCTTCCTTTGTCGTGG + Intergenic
959602284 3:108201002-108201024 GACAGTACCTGACATTGTGCTGG - Intronic
960523778 3:118685458-118685480 GATAGTTCATGGCTCTGTGGGGG - Intergenic
961676231 3:128568630-128568652 GTCACTTCCTGTCTTTGTTGGGG - Intergenic
961721676 3:128901124-128901146 CAAAGTTCCTATCTTTGTGGAGG - Intronic
961847120 3:129775118-129775140 GACATTTGCTGGCTTGGTGGGGG + Intronic
962751426 3:138436983-138437005 GACAGTTCTGGCCTCTGTTGGGG + Intronic
968359436 3:198137027-198137049 CACAGTCCCTGCCTTTGAGCTGG + Intergenic
968363489 3:198166362-198166384 GACAGTTCATTCCTTTCTGTTGG + Intergenic
968993916 4:3933458-3933480 GAAAGTTCCAGCCTTCTTGGTGG + Intergenic
969572344 4:8016654-8016676 GACAGCTCCTGCCTGCGTGCTGG + Intronic
969822311 4:9730129-9730151 GAAAGTTCCAGCCTTCTTGGTGG - Intergenic
970558726 4:17261388-17261410 GAATTTTCCTGCCTTTGTCGTGG - Intergenic
975887758 4:78985419-78985441 GTCTGTTCCTGCCTTTGCAGAGG + Intergenic
976294055 4:83452019-83452041 GACAGTTGCTGCCATACTGGAGG - Intronic
980891441 4:138819244-138819266 GACACCTCCTGCTTTTGTGTTGG - Intergenic
986131647 5:4937451-4937473 GACAGTGCCTGGCTCTGTGTTGG - Intergenic
986654463 5:9997404-9997426 GACTGCTCCTGACTTGGTGGGGG - Intergenic
998166280 5:139846232-139846254 GACAGGTCCTGGCTCTGAGGGGG + Intergenic
1000586306 5:163103243-163103265 GACAGTGTCTGCCTTTATGGGGG - Intergenic
1001551038 5:172602581-172602603 GACAGTTCCTGTTTCTGTTGAGG - Intergenic
1001680801 5:173555534-173555556 GACAGTTCTTGCCTTGGCAGGGG - Intergenic
1002468295 5:179419140-179419162 GACAGTGTCTGCCTGTGGGGAGG + Intergenic
1003305324 6:4922002-4922024 TACCGTTCCTGCCTCTGTGGTGG + Intronic
1004367588 6:15024898-15024920 AACAGTTTCTTTCTTTGTGGGGG + Intergenic
1005805978 6:29474969-29474991 GGCAGTCCCTGCCTTTGTGGAGG + Intergenic
1006832765 6:36978477-36978499 GACTGTTCCTGGCTTTGTGTGGG + Intronic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1014760742 6:125354122-125354144 GACAGTAATTGCCTCTGTGGTGG - Intergenic
1015984571 6:138872365-138872387 GACAGTTCCTGCCTTTGTGGAGG + Intronic
1016281018 6:142418721-142418743 GACAGCTTTTGCCTTTGTGGAGG + Intronic
1019252212 7:22311-22333 GACAGTTCATTCCTTTCTGTTGG - Intergenic
1019260562 7:79649-79671 CACAGTCCCTGCCTTTGAGCTGG - Intergenic
1019344467 7:522597-522619 GACAGAGCCTGGCTTTGTGCGGG + Intergenic
1019708917 7:2509590-2509612 GACAGTGTCCCCCTTTGTGGCGG - Intergenic
1020316538 7:6909371-6909393 GAAAGTTCCAGCCTTCTTGGTGG + Intergenic
1020414910 7:7934509-7934531 GACAGATCTTGCTTTTGTTGAGG + Intronic
1023345092 7:39263813-39263835 AACAGTTCCTGCCTTCGGGGAGG - Intronic
1026114290 7:67483335-67483357 AAAAGTTCCTGTGTTTGTGGAGG - Intergenic
1028842165 7:95440517-95440539 GACCTTCCCTGCCTTGGTGGCGG + Intergenic
1028917226 7:96272543-96272565 GACCGTTCCTGCCTTTGACCTGG - Intronic
1029344299 7:99967269-99967291 CACAGATCCTCCCTCTGTGGTGG - Exonic
1029347194 7:99987253-99987275 CACAGATCCTCCCTCTGTGGTGG + Intergenic
1031667581 7:124503835-124503857 GACCTTTCCTGCCTTTGGGTAGG - Intergenic
1032415367 7:131731613-131731635 GACACCTCCTGCCTTGCTGGTGG + Intergenic
1032773832 7:135089951-135089973 CACAGATCCTGGCTCTGTGGAGG - Intronic
1033492353 7:141855728-141855750 CACGGTTCCTGCCTCTGTGTGGG - Intergenic
1041015630 8:53590732-53590754 GACTCTTCCGGCCTTAGTGGAGG - Intergenic
1042719658 8:71813578-71813600 TAAAGTTCCAGCCTTTGAGGGGG + Intergenic
1042960523 8:74299039-74299061 GACCTTTACTGCCTTTGAGGGGG + Intronic
1043603472 8:81970450-81970472 GACAGCTCCTCCGTTTGTGATGG - Intergenic
1044546422 8:93465339-93465361 GACAGTTCCTGGGGTTCTGGGGG + Intergenic
1045503743 8:102763253-102763275 GACGGTGGCTGCCTTTGGGGTGG - Intergenic
1046053271 8:109048643-109048665 GACAGTCTATGCCTTTTTGGGGG - Intergenic
1051809154 9:21031019-21031041 AGCAGTTCCTGCCTTTATAGGGG - Intronic
1054867903 9:70021470-70021492 AACAAATCCAGCCTTTGTGGTGG - Intergenic
1056122383 9:83502277-83502299 GAAGGTTCCTGCCTTTTTGATGG + Intronic
1056751817 9:89357517-89357539 GGCAGTTCCTGTCAGTGTGGTGG + Exonic
1057305526 9:93910111-93910133 AACAGTCCCTGCCCTGGTGGGGG + Intergenic
1057490595 9:95516843-95516865 GACAGGTCCTGCCTATGGCGCGG - Intronic
1057700911 9:97362486-97362508 GTCATCTCCTGCCTTTGTGTGGG - Intronic
1057749658 9:97781730-97781752 GACAGTTACTGCCTGTGTCATGG + Intergenic
1058835605 9:108856284-108856306 TACAGTGCCTGCCTTACTGGAGG - Exonic
1058967716 9:110052779-110052801 GACAGTTCGGGATTTTGTGGTGG + Intronic
1058999993 9:110338716-110338738 GACAGTGGCTGCCTCTGTAGAGG + Intergenic
1061952335 9:133943505-133943527 AGCAGTGGCTGCCTTTGTGGGGG - Intronic
1062203272 9:135320501-135320523 AACAGTGCCTGCCTTCGGGGAGG + Intergenic
1062744124 9:138200741-138200763 CACAGTCCCTGCCTTTGAGCTGG + Intergenic
1062748130 9:138229604-138229626 GACAGTTCATTCCTTTCTGTTGG + Intergenic
1185720444 X:2377047-2377069 TACAGTATCTGCCTTTGTCGTGG - Intronic
1186374202 X:8980971-8980993 GACCTTTCCTTTCTTTGTGGAGG + Intergenic
1186842351 X:13496397-13496419 GACAATTCCTGCCTGTATGCAGG + Intergenic
1187864890 X:23715056-23715078 GACTGTTCCTGCAATTGAGGGGG - Intronic
1188153486 X:26710386-26710408 GGCAATTCCTGCCTTTATGCAGG - Intergenic
1188244181 X:27821005-27821027 GGCAGGTCCAGGCTTTGTGGAGG - Intronic
1189896389 X:45660686-45660708 GACAGTATCTGCTTCTGTGGAGG - Intergenic
1191871308 X:65748029-65748051 AAAAGTCCCTGCCTTTGTGAAGG - Intergenic
1194141885 X:90218586-90218608 GACAGTGTGTGCCTTTTTGGTGG + Intergenic
1199513358 X:148648207-148648229 GGCAGTTCCTCTGTTTGTGGTGG + Intronic
1200487646 Y:3787699-3787721 GACAGTGTGTGCCTTTTTGGTGG + Intergenic
1202162916 Y:21954118-21954140 GTCAGATACTGCCTGTGTGGAGG + Intergenic
1202228440 Y:22632250-22632272 GTCAGATACTGCCTGTGTGGAGG - Intergenic
1202314717 Y:23563926-23563948 GTCAGATACTGCCTGTGTGGAGG + Intergenic
1202556084 Y:26106667-26106689 GTCAGATACTGCCTGTGTGGAGG - Intergenic