ID: 1015984941

View in Genome Browser
Species Human (GRCh38)
Location 6:138875414-138875436
Sequence CCCTTGGATGTCCAGGGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015984941_1015984948 7 Left 1015984941 6:138875414-138875436 CCTCATCCCTGGACATCCAAGGG 0: 1
1: 0
2: 1
3: 19
4: 204
Right 1015984948 6:138875444-138875466 TGGTAGTTTTGTCTTTGATGAGG 0: 1
1: 0
2: 1
3: 18
4: 268
1015984941_1015984949 11 Left 1015984941 6:138875414-138875436 CCTCATCCCTGGACATCCAAGGG 0: 1
1: 0
2: 1
3: 19
4: 204
Right 1015984949 6:138875448-138875470 AGTTTTGTCTTTGATGAGGAAGG 0: 1
1: 0
2: 0
3: 28
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015984941 Original CRISPR CCCTTGGATGTCCAGGGATG AGG (reversed) Intronic
900119352 1:1041879-1041901 CCCTGGGATGTGCAGGGAGCAGG - Intronic
900603624 1:3514403-3514425 CCCTTGGGTGACCTGGGATGTGG - Intronic
900911173 1:5597943-5597965 CCCTGGAATGTCCAGGGAGCAGG - Intergenic
901149126 1:7088647-7088669 TCTTTGGATGTCCAGGGTTTTGG + Intronic
901597878 1:10399349-10399371 CCCTTCGAGGGCCAGGGAGGAGG + Intronic
902409694 1:16205720-16205742 CCCGTGGATGGCCAGGGTTGTGG - Intronic
903853244 1:26320793-26320815 GCCTGGGATGTCCAGGGTGGTGG - Intergenic
904478869 1:30782050-30782072 CCCTGGGATGTCCCAGGAAGGGG + Intergenic
904939525 1:34155708-34155730 TGCTTGGCTTTCCAGGGATGGGG - Intronic
905031140 1:34885331-34885353 CCCGTCGATGTCCAGGCACGGGG + Intronic
905469972 1:38184607-38184629 ACCATTGGTGTCCAGGGATGGGG + Intergenic
906198495 1:43944767-43944789 CCCTGGAACCTCCAGGGATGAGG + Intergenic
906902790 1:49854629-49854651 TCCTTGGGGCTCCAGGGATGTGG - Intronic
907559805 1:55378041-55378063 CCTAAAGATGTCCAGGGATGTGG + Intergenic
911718092 1:101158517-101158539 AGCTGGGAGGTCCAGGGATGGGG + Intergenic
913090779 1:115475247-115475269 GCCTTTTTTGTCCAGGGATGGGG + Intergenic
914754944 1:150557251-150557273 CCCAGGGGTGTCCTGGGATGGGG - Exonic
917924066 1:179774367-179774389 CCCATGGATGCCCAGGGAAGTGG + Intronic
918045424 1:180938364-180938386 CTCTTAGATGACCAGGGCTGAGG - Intronic
920755582 1:208728001-208728023 CCTTTGGATGTTCACAGATGAGG - Intergenic
922180859 1:223231677-223231699 TCCTGGGAGATCCAGGGATGTGG + Intronic
923838355 1:237640166-237640188 CCCTTGCATGCCCAGGAATGAGG + Intronic
924938078 1:248789188-248789210 AACTTGGAGGACCAGGGATGAGG + Intergenic
1063255279 10:4320761-4320783 CACTGGGGAGTCCAGGGATGGGG + Intergenic
1066477877 10:35765248-35765270 CCCTGGGAGGTCCGGGGGTGCGG - Intergenic
1066541549 10:36452152-36452174 CCCTTCCTTGTCCAGGGTTGGGG - Intergenic
1067179023 10:43971104-43971126 GCCTTGGATGTCTAGAGAGGGGG + Intergenic
1067448026 10:46364819-46364841 CCCGGGGAAGTCCAGGGGTGTGG - Intergenic
1067589354 10:47495942-47495964 CCCGGGGAAGTCCAGGGGTGTGG + Intergenic
1067636478 10:48004021-48004043 CCCGGGGAAGTCCAGGGGTGTGG + Intergenic
1067877011 10:50016304-50016326 CCCAGGGAAGTCCAGGGGTGCGG - Intergenic
1068065249 10:52122082-52122104 CACTGGGATGTCCAAGGTTGAGG + Intronic
1070133027 10:73668005-73668027 CCCGGGGAAGTCCAGGGGTGTGG + Intergenic
1071483968 10:86085711-86085733 CCCTGGGATCCCCAGGGATATGG - Intronic
1072637072 10:97185277-97185299 CCCTTTGAATCCCAGGGATGGGG + Intronic
1073492847 10:103866276-103866298 CTCTTGGATTTCCTGGAATGGGG - Intergenic
1074260956 10:111852792-111852814 CCCATGATTGGCCAGGGATGGGG - Intergenic
1075965134 10:126604658-126604680 CCTTTGGATGTGGAGAGATGTGG - Intronic
1076518348 10:131062668-131062690 TCAGTGGATGTTCAGGGATGAGG + Intergenic
1077350430 11:2090704-2090726 GGCTTGGCTGTCCAGGGCTGAGG + Intergenic
1086272974 11:85090375-85090397 CCATTGGATGTGGAGAGATGGGG - Intronic
1088583282 11:111335441-111335463 CCCTTGAATATTCAGGGATCTGG - Intergenic
1088707587 11:112477673-112477695 CCCTCGGGAGTCCAGAGATGAGG + Intergenic
1089760419 11:120718691-120718713 CAGGTGGATGTCCAGGGCTGTGG + Intronic
1090959646 11:131544731-131544753 TCCTTGTATGCCCAGGGCTGCGG - Intronic
1091216708 11:133906767-133906789 CCCTGGGATGCACTGGGATGTGG - Intergenic
1092289332 12:7149774-7149796 TCCTTCCAGGTCCAGGGATGTGG + Intronic
1092612149 12:10184018-10184040 TCCTTGGATGTTGAGGGGTGAGG - Intronic
1094014330 12:25846421-25846443 GCCTTGAATGTCCAGATATGTGG - Intergenic
1102871614 12:116418556-116418578 CCCTTGGAGTTCCTGGGATCTGG - Intergenic
1105957809 13:25300955-25300977 CCGCTGGATTTCCTGGGATGCGG - Intergenic
1107243371 13:38264562-38264584 CCCTTGGCTGGACTGGGATGGGG - Intergenic
1108409637 13:50133432-50133454 CCTTTGGATGTCTAGGGTCGGGG + Intronic
1111567414 13:90033341-90033363 CCCTTGGTGGTCATGGGATGGGG + Intergenic
1115858397 14:37656782-37656804 TCCTTGGAATTCCAGGGATGGGG + Intronic
1121229264 14:92344647-92344669 GTTTAGGATGTCCAGGGATGAGG + Intronic
1122087500 14:99317876-99317898 CCCATGGCTGCCCAGTGATGTGG - Intergenic
1122792256 14:104188988-104189010 CCCTGAGATGGGCAGGGATGGGG + Intergenic
1126539651 15:49807910-49807932 CCCTTTGATGGACAGGGAAGGGG - Intergenic
1126911298 15:53419760-53419782 CCCTTGGGAGTCCACAGATGAGG + Intergenic
1128678369 15:69628290-69628312 TCCTTGGATCTCCATGGAGGAGG - Intergenic
1131058635 15:89391119-89391141 CCCTTGCAGGTCCTGGGATGGGG + Intergenic
1131317398 15:91352047-91352069 GCCTTGGATGGCCAGGGCAGAGG - Intergenic
1132161277 15:99545141-99545163 CCCTGGGAGGTCGAGGGTTGAGG + Intergenic
1132791250 16:1689931-1689953 CCCTGGGAGGTCCATGGCTGAGG + Intronic
1132999392 16:2841453-2841475 GCCCTTGATGTCCAGGGATGAGG + Intergenic
1133622628 16:7541067-7541089 GCCTTGGATTTCCAGGTGTGTGG - Intronic
1134118473 16:11567084-11567106 CCCTAGGATGTCCAGGCAGGAGG + Intronic
1134745570 16:16585486-16585508 CCCTTGGATGCCTTGGGAAGTGG - Intergenic
1135880089 16:26247148-26247170 CCCTCAGAAGTCAAGGGATGGGG + Intergenic
1137349292 16:47697313-47697335 CTCTTTGATGTCCCAGGATGTGG + Intronic
1137451458 16:48578280-48578302 CCCCTGGGGGTCCTGGGATGAGG - Intronic
1137782905 16:51113207-51113229 CCCTTGGAGGTTTGGGGATGGGG - Intergenic
1137800673 16:51259475-51259497 CCCCTAGATGACCAGGGATGGGG + Intergenic
1137977568 16:53044185-53044207 CCCTTGGATGTTCCAGGAGGAGG + Intergenic
1139252294 16:65507945-65507967 CCCCGGGATCTACAGGGATGGGG + Intergenic
1139536755 16:67580447-67580469 ACCTTGGATGGCCTGGGAGGAGG - Intronic
1139567979 16:67791600-67791622 CCCTGGGAGGTCTAGGGTTGGGG - Intronic
1139789625 16:69423263-69423285 ACCTGGGATGACCACGGATGTGG + Intergenic
1141427584 16:83953804-83953826 CGCTGGGACCTCCAGGGATGGGG - Intronic
1142155835 16:88532549-88532571 ACCTTGGGACTCCAGGGATGAGG - Intronic
1144954546 17:19012520-19012542 CCCAGGGATGACAAGGGATGAGG + Intronic
1146534703 17:33640020-33640042 CCCTTAGAAGCCCAGGGGTGAGG - Intronic
1147599008 17:41734362-41734384 CCCTTGGATGGCCGAGAATGCGG + Exonic
1148755271 17:49969856-49969878 TCCTTGGATTCCCTGGGATGTGG + Intronic
1153140504 18:1967102-1967124 CCATTGGATGTCATGAGATGAGG + Intergenic
1153531869 18:6054843-6054865 CCCCTGCATGGCCAGGGAGGTGG + Intronic
1156481509 18:37439472-37439494 GCTGTGGATGTCCAGGGGTGTGG - Intronic
1156822750 18:41392434-41392456 ACCTTGGCTAACCAGGGATGGGG + Intergenic
1157481563 18:48058520-48058542 CCCTGGGATGACCAGAGAGGTGG - Intronic
1157493234 18:48138233-48138255 GCCATGAAGGTCCAGGGATGAGG + Intronic
1157759044 18:50245772-50245794 CCCTTGCATGTCCAGGTATCTGG - Intronic
1160874350 19:1290306-1290328 CCCCAGGATGCCCAGAGATGGGG - Intronic
1161328032 19:3672825-3672847 ACCTTGGTTCTACAGGGATGAGG - Intronic
1161460057 19:4391204-4391226 CCCCTGGGTGGCCAGGGGTGGGG + Intronic
1161461405 19:4400066-4400088 CCCTGGGCTGCCCAGGGACGCGG - Intronic
1164563578 19:29310414-29310436 CCCTTTGAGGTGCAGGGGTGGGG - Intergenic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1165313659 19:35042241-35042263 CGCCTGGATTTGCAGGGATGGGG - Exonic
1166258861 19:41624403-41624425 CCATTTCATGTCCAGAGATGCGG + Intronic
1168267436 19:55230467-55230489 CCCGTGGATCTCCCGGGGTGGGG - Exonic
928210277 2:29318918-29318940 ACCTTGGAAGATCAGGGATGTGG - Intronic
929250246 2:39746224-39746246 ACCTTGGATGCCCAAGAATGAGG - Intronic
930030491 2:47055650-47055672 CCCTTGGACCTCCAGGGTAGGGG - Intronic
930726410 2:54686234-54686256 CCCTTGGTCATCCAGGGATGTGG + Intergenic
933145085 2:78842150-78842172 CACTAGGATGTCAAGGGAAGTGG - Intergenic
935827103 2:106962750-106962772 CCCTGGGCTGCCCAGGCATGGGG + Intergenic
936402360 2:112175196-112175218 CACTGGAATGTCCAGGGTTGGGG - Intronic
937052246 2:118901992-118902014 CCCTGGGAGGGGCAGGGATGAGG - Intergenic
937073711 2:119085297-119085319 GCTTTGGATGCCCAGGGATATGG + Intergenic
938319633 2:130354559-130354581 CCCTTGGATGTTCATGGGGGGGG - Intergenic
939952444 2:148490961-148490983 CCTTTGGAGGTCCAGGAGTGTGG + Intronic
942564265 2:177250949-177250971 CCCAAGGATGTCCAAGGATGAGG + Intronic
942814235 2:180033479-180033501 CCTTGGCATGTCCAGAGATGTGG + Intergenic
942955846 2:181772567-181772589 CCCTTGGGTGTTCATGGAGGAGG + Intergenic
943524156 2:188995768-188995790 TCCCTGGAGGTCCAGGAATGAGG + Exonic
944410619 2:199438980-199439002 CCCTTAGATTTCAATGGATGTGG - Intronic
944885478 2:204058387-204058409 TGCTGGGAAGTCCAGGGATGGGG + Intergenic
1171360731 20:24584779-24584801 TCCTGGGGTGTCCAGGGATGTGG - Intronic
1172005395 20:31815943-31815965 CCCTTGGAGGCACAGGGGTGGGG - Intergenic
1173964579 20:47102413-47102435 CCCATGGATGTCCAGTGAATGGG + Intronic
1173979215 20:47210272-47210294 CCCCTGGGTATCCAAGGATGAGG + Intronic
1174308374 20:49631434-49631456 CTCTTGGATTTCCTGGGAAGGGG - Intergenic
1174569556 20:51492067-51492089 TTCTGGGATGTGCAGGGATGCGG - Intronic
1175408312 20:58749599-58749621 CCCCAGCATGTCCCGGGATGAGG - Intergenic
1175598166 20:60252147-60252169 GCCTTGACTGTCCAGGGATGAGG + Intergenic
1175625413 20:60484958-60484980 CCCTTGGGAGACCAGGGAGGAGG - Intergenic
1175634932 20:60573571-60573593 CCATTTGATGTCCATGAATGAGG + Intergenic
1176073185 20:63237246-63237268 GCCTTGGACTTCCAGGGAGGTGG - Intronic
1179963473 21:44785393-44785415 ACCTTGGAAGACCAGGGTTGAGG - Intronic
1180820895 22:18826947-18826969 ATCTTGGCTGTCCAGGGAAGGGG - Intergenic
1181192082 22:21149098-21149120 ATCTTGGCTGTCCAGGGAAGGGG + Intergenic
1181207115 22:21261412-21261434 ATCTTGGCTGTCCAGGGAAGGGG - Intergenic
1181403097 22:22663640-22663662 CCCATGGATGTGCTGAGATGGGG + Intergenic
1181670188 22:24422313-24422335 CCCTTGCATCTGGAGGGATGTGG - Intronic
1181749303 22:24977645-24977667 CCCTTAGATTCCCAGGGTTGGGG + Intronic
1182121193 22:27787951-27787973 CCCATGCATGTGCAGCGATGTGG + Intronic
1182151088 22:28027749-28027771 CCCATGTATGGCCAGGGATCTGG - Intronic
1182280511 22:29215452-29215474 CCCATGGGTGTCCAGGGCAGTGG + Intronic
1183072099 22:35403344-35403366 CCCTGGGAAGCTCAGGGATGGGG - Intronic
1183672926 22:39283553-39283575 CCCTGGCCTGTCCAGGGAGGCGG + Intergenic
1183739159 22:39660665-39660687 CCCTGGTATGTGGAGGGATGTGG - Intronic
1203219805 22_KI270731v1_random:34004-34026 ATCTTGGCTGTCCAGGGAAGGGG + Intergenic
1203271022 22_KI270734v1_random:52823-52845 ATCTTGGCTGTCCAGGGAAGGGG - Intergenic
949646999 3:6106955-6106977 CTCTTGGATTTCCAGTGATTTGG - Intergenic
950446825 3:13043305-13043327 CCCTTGTATCTCCTGGGATCTGG + Intronic
950645334 3:14373606-14373628 CCCTTGGAGGGCCATGGCTGGGG + Intergenic
950664640 3:14487918-14487940 CCCCTCCATGTTCAGGGATGAGG + Exonic
950721067 3:14882965-14882987 CCCAAGGCTGTCCAGTGATGAGG + Intronic
952445653 3:33378378-33378400 AGCTTGCATGTCCAGTGATGGGG + Intronic
952813122 3:37422822-37422844 CACTAGGATGTCCAGAAATGAGG - Intronic
953229661 3:41053358-41053380 CTATTGGATGTGGAGGGATGTGG + Intergenic
953399870 3:42603520-42603542 GCCTTGGATGTTGAGGAATGAGG - Intronic
953890969 3:46751181-46751203 CCATTAGTAGTCCAGGGATGCGG - Intronic
955446730 3:59019431-59019453 CCCTTGTTTGTTGAGGGATGTGG + Intronic
962805991 3:138928299-138928321 GCCTTGGTTGGCCAGGGCTGAGG + Intergenic
966794278 3:183698435-183698457 GCTTTGGGGGTCCAGGGATGGGG + Intronic
966870768 3:184289341-184289363 CCCCTGGGTGGACAGGGATGGGG + Intronic
967721439 3:192820402-192820424 CCTTTCAAAGTCCAGGGATGAGG + Intronic
969217612 4:5734823-5734845 CCCATGGAGGTCCCTGGATGGGG + Intronic
970049825 4:11901172-11901194 ACTTTTGATATCCAGGGATGAGG - Intergenic
970150274 4:13082046-13082068 CACTTGGATGTCCAGGCAGAAGG - Intergenic
972814471 4:42628945-42628967 CCCTTGGATGTCCTTAGCTGAGG + Intronic
973795821 4:54425231-54425253 CCCTAGGACCTGCAGGGATGTGG - Intergenic
979189179 4:117835292-117835314 CCCTTGCAGGTCCTGCGATGAGG + Intergenic
979703523 4:123694090-123694112 CCCTTGGATACTGAGGGATGAGG + Intergenic
985192548 4:187391624-187391646 CCTTTGCAGGTCCAGGGATCAGG + Intergenic
986556087 5:9011027-9011049 GCCTTGGCTGTCCAGTGGTGGGG - Intergenic
990090354 5:52038677-52038699 TCCTTGGATCTCTAGGGATTAGG - Intronic
992436849 5:76762726-76762748 CCATTGGTTATCCAGGAATGGGG + Intergenic
993889354 5:93454685-93454707 CCCTCAGATCTCCGGGGATGGGG + Intergenic
997820207 5:137058766-137058788 CCCATGGATGTCTGGGGAAGAGG + Intronic
998899171 5:146833960-146833982 CCCTAGGATGTGCATGGAAGTGG - Intronic
999279583 5:150356498-150356520 CCCTAGGAGGTCCAGGTATGTGG - Intergenic
1000284438 5:159815001-159815023 CCATTGGAGGTTTAGGGATGGGG + Intergenic
1001094520 5:168766017-168766039 CATTTGGATGACCAGGGGTGTGG + Intronic
1003595655 6:7471981-7472003 CACTTGGAGGTCAAGGGAGGAGG - Intergenic
1007159672 6:39778889-39778911 CCATTGGGTGTGCAGGGGTGGGG - Intergenic
1008761555 6:54857985-54858007 CTGTTGGATATCCAGGGAAGAGG + Intronic
1012666817 6:101981370-101981392 CACTTGGAGGTACAGGGATGTGG + Intronic
1015939024 6:138430840-138430862 CGCTTGGAGCTCCAGGGCTGCGG + Exonic
1015984941 6:138875414-138875436 CCCTTGGATGTCCAGGGATGAGG - Intronic
1018901180 6:168052512-168052534 AGCGTGGATGTCCAGGGCTGTGG + Intergenic
1019135893 6:169907554-169907576 CTCTTGGAGGTTGAGGGATGTGG + Intergenic
1020657858 7:10949190-10949212 CCATTGGATGACCAGGGATTTGG - Intergenic
1022445687 7:30468882-30468904 TGCTTGGATGTTCAGGGTTGTGG + Intronic
1024430767 7:49285551-49285573 CCCTTGTATCTACAGGGATCAGG + Intergenic
1024919807 7:54545082-54545104 CTCCCGGATGTCCCGGGATGTGG - Intronic
1025026174 7:55518005-55518027 CCCTCGCATGTGCAGGGAAGTGG + Intronic
1026329140 7:69336909-69336931 CCCTGGGAATTCCAGGGCTGAGG + Intergenic
1026509420 7:71015932-71015954 CCCTTGGGTGTCCAGAAAGGAGG + Intergenic
1027513853 7:79116577-79116599 ACCTTGGTATTCCAGGGATGTGG + Intronic
1029251914 7:99243117-99243139 CCCCTGTGTGTCCTGGGATGGGG - Intergenic
1029381718 7:100219640-100219662 CCCCTTGCTGTCCAGGGAAGGGG + Intronic
1033214175 7:139482218-139482240 TCCTTGGCAGTGCAGGGATGGGG + Intronic
1035105714 7:156440340-156440362 CCCTTAGATGCCCAGGAAGGAGG + Intergenic
1037779235 8:21856299-21856321 CCCAAGGATGACCTGGGATGGGG + Intergenic
1038352258 8:26787712-26787734 CACTTGGTAGTTCAGGGATGAGG + Intronic
1038386877 8:27156734-27156756 CCCTTGGGGGGCCAGGTATGTGG - Intergenic
1039880190 8:41620878-41620900 CCTTTGTCTCTCCAGGGATGGGG + Exonic
1040063905 8:43128393-43128415 TTCTTGGGGGTCCAGGGATGTGG + Intergenic
1043946523 8:86260265-86260287 ACCATGGAAGTCCAGGGATAGGG - Intronic
1047041060 8:120996063-120996085 CCTTGGGATGTCCAGGGATGGGG + Intergenic
1047182660 8:122604345-122604367 CACTTTGATTTCCAGGCATGAGG - Intergenic
1048295555 8:133211117-133211139 ACCTTGAAGGACCAGGGATGAGG - Intronic
1049473601 8:142787000-142787022 CCCGTGGGTGTCCAGGGCAGGGG + Intergenic
1049493013 8:142914989-142915011 CCCTGGAGTGGCCAGGGATGGGG - Intronic
1049697548 8:143991271-143991293 CCCCCGGATATCCAGGGTTGGGG - Exonic
1053013391 9:34647981-34648003 CCCCTGGATGGGCAGGGAGGGGG + Intronic
1055369740 9:75584373-75584395 CCCTTGGATGTCCTTGATTGAGG - Intergenic
1057294518 9:93827530-93827552 CCCTTGGGTCTCTAGGGATCTGG - Intergenic
1057900502 9:98944339-98944361 CCCTTTTATGTCCAGGAATGAGG - Intronic
1058086885 9:100757124-100757146 TCATAGGATGTCTAGGGATGAGG + Intergenic
1058599915 9:106658256-106658278 ACTTTGGTTGCCCAGGGATGTGG - Intergenic
1185587159 X:1248690-1248712 CCTTTGGAATTCCAGGGGTGGGG - Intergenic
1187365244 X:18661271-18661293 CCCTTGCATGCCCTGAGATGGGG - Intronic
1190117296 X:47634604-47634626 CCCTTGCATGCCCAGTGATGTGG + Intergenic
1190992396 X:55566013-55566035 CCCTTGCAGCTCCAGGGGTGGGG - Intergenic
1192606469 X:72524352-72524374 CCTAGGGATGCCCAGGGATGTGG + Intronic
1194504559 X:94716253-94716275 TCCTTGGAGGTCCGGGGCTGAGG - Intergenic
1195212368 X:102661793-102661815 TCCTTGGAGGTCAAGGGGTGAGG + Intergenic
1195218409 X:102722542-102722564 TCCTTGGAGGTCAAGGGGTGAGG + Intronic
1197897791 X:131334060-131334082 CTCTGGGATGGCCAGGGATTTGG - Intronic
1199659636 X:150036023-150036045 CCCTTTGCTTTCCAGGGAAGAGG + Intergenic
1200238937 X:154483613-154483635 CCCATGTGTGTCCAGGGAAGTGG + Intergenic