ID: 1015985061

View in Genome Browser
Species Human (GRCh38)
Location 6:138876207-138876229
Sequence CTCCCTCTTCCTTGGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 389}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015985061_1015985065 27 Left 1015985061 6:138876207-138876229 CCTGGCTCCCAAGGAAGAGGGAG 0: 1
1: 0
2: 4
3: 35
4: 389
Right 1015985065 6:138876257-138876279 ATGTAGTTCAAAAGAAGCAAAGG 0: 1
1: 0
2: 4
3: 18
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015985061 Original CRISPR CTCCCTCTTCCTTGGGAGCC AGG (reversed) Intronic
900098770 1:952079-952101 CTGCCTCTTCCTGTGGTGCCGGG - Exonic
900299921 1:1971897-1971919 GCCCCTGCTCCTTGGGAGCCAGG - Intronic
900426915 1:2585197-2585219 CTGCCGCCTCCTTGGGAGCTGGG - Intergenic
900430857 1:2602601-2602623 CTCACTCTTACTTGTGAACCAGG + Intronic
900867323 1:5277599-5277621 CTCCCTCTCCCTGGGGAGAAGGG - Intergenic
901041017 1:6363621-6363643 CTCTCTCTGCCTTGGCTGCCAGG + Intronic
901115689 1:6841979-6842001 CCCTTTCTTCCTGGGGAGCCTGG + Intronic
903577024 1:24345376-24345398 CTCCCTGTTCCTTGCAAGCTAGG + Intronic
904381991 1:30117653-30117675 CTGCCTCTTGCTTGGCAGCTGGG - Intergenic
905834900 1:41109659-41109681 CTCTCTCTACCTTCTGAGCCTGG + Intronic
906177471 1:43787218-43787240 CTGCCTCTGGCCTGGGAGCCAGG + Intronic
906520052 1:46461544-46461566 CTCTCTCTTCCTTAGCTGCCTGG + Intergenic
907480468 1:54742368-54742390 ATCCCTCTGCATTGGGAGCAGGG - Exonic
908818560 1:68058631-68058653 CTCTCTCTGCCTTGGCTGCCAGG + Intergenic
912543079 1:110431520-110431542 CTCCCTCTTTCCTGCGGGCCCGG + Intergenic
914412033 1:147438606-147438628 CCCCCTCCTCCCTGGTAGCCAGG + Intergenic
915666531 1:157450240-157450262 CCCCCTCTTTCTGGGCAGCCAGG + Intergenic
916209875 1:162351756-162351778 CTCTCCTTTCCTTGGTAGCCAGG + Intronic
917699700 1:177567936-177567958 CTCTCTCTTAAGTGGGAGCCTGG + Intergenic
920436292 1:205949179-205949201 CTCCCTTGTCCCAGGGAGCCAGG + Intergenic
920754500 1:208716235-208716257 CTCACTTTAGCTTGGGAGCCTGG - Intergenic
921132539 1:212232192-212232214 CTCCCACTTCCTTAGCAGCCGGG + Intergenic
921893472 1:220375850-220375872 TTCCCTCTTGCTTGGGAGGAGGG + Intergenic
921923130 1:220690416-220690438 CTCCGCCTTGCTTCGGAGCCTGG - Exonic
922055238 1:222036396-222036418 ATCCCTCTTCCTTGAGGGCGAGG - Intergenic
922172448 1:223167133-223167155 CTCCATCTTCAATGGGAGCTGGG + Intergenic
922935721 1:229420741-229420763 CTCCCTCTTCCATGGCAGAATGG + Intergenic
923495574 1:234521648-234521670 CTCTCTTTTCCGTGGGAGCCAGG - Intergenic
1062975206 10:1677867-1677889 CTCACTCTCCCTAGGAAGCCAGG + Intronic
1063382255 10:5592830-5592852 CTCCCTCTCCGTTGTGATCCGGG - Intergenic
1063929901 10:11018286-11018308 CTCCCTCGGCCTTCGGAGGCCGG + Intronic
1065308526 10:24391660-24391682 CTCTTTCTTCCTTTGCAGCCAGG + Intronic
1065534996 10:26707868-26707890 TTTCCTGTTCCTTGGGAACCTGG + Intronic
1065661040 10:28004422-28004444 CTCCCTCTTCCTGATGATCCAGG + Intergenic
1066527691 10:36298988-36299010 CTCCTTCGTTCTTGGGAGTCAGG + Intergenic
1067051198 10:43022373-43022395 CTCATTCCTCATTGGGAGCCAGG - Intergenic
1067658891 10:48218811-48218833 ATCACTCTTACTTTGGAGCCTGG - Intronic
1069606875 10:69744264-69744286 CTTCCTCTTCCTGGGGAGGCAGG + Intergenic
1070631045 10:78084941-78084963 CCCCCTCTTCCTTCAGATCCAGG + Intergenic
1070840724 10:79486121-79486143 GTCCCACTTACTTGGGAGGCTGG + Intergenic
1071269382 10:83992517-83992539 TTCCCACGTCCTTGGGAGCCTGG - Intergenic
1071513517 10:86282235-86282257 CTGCCTCTACCTTTGGAGGCTGG - Intronic
1072790870 10:98316969-98316991 CTCCCTCTGCCCTGGGTGCTAGG + Intergenic
1074252757 10:111769004-111769026 TTCCCTCTATCTTGGGAGCTGGG + Intergenic
1074386056 10:113017535-113017557 CTCCCTCCTCCTTCCCAGCCAGG - Intronic
1074877435 10:117625020-117625042 CTCCATCTTCCTTGGGAACACGG - Intergenic
1075958382 10:126545185-126545207 CTCTCTCATCCTCCGGAGCCAGG + Intronic
1076364358 10:129912194-129912216 CTCCCTCTACCTTGGAGGCCAGG - Intronic
1076504349 10:130962196-130962218 CTCCCTCTTCCCTGAGACCAGGG + Intergenic
1076536829 10:131183836-131183858 CTGCCTCCTTCTTGGGAGACAGG + Intronic
1076689067 10:132211657-132211679 CTGCCTCCTCCTTGGGTGGCTGG + Intronic
1076912318 10:133397242-133397264 CTCTCTCTGCCTTGGCTGCCAGG + Intronic
1077217182 11:1399800-1399822 CTCCTTCTTCCTTGGCACCCTGG + Intronic
1077520111 11:3028147-3028169 CTCTCTCTGCCTTGGCTGCCAGG + Intronic
1077538063 11:3133933-3133955 CTCCCTCTTCCCTGGCCTCCTGG - Intronic
1078006557 11:7536746-7536768 CTCCCTCTGCCTGGGGAACCAGG - Intronic
1078941672 11:16013433-16013455 GTTCCTCTGCCTAGGGAGCCAGG - Intronic
1079129381 11:17738489-17738511 CAGCCTCTTGCTTGGGAGTCAGG - Intronic
1080334068 11:31175394-31175416 CCCCCTGTTCCTTGGGAGAATGG - Intronic
1081670736 11:44941068-44941090 TTCCCACTTCCTAGGGAGCCCGG + Exonic
1081748451 11:45489393-45489415 CTCCCCCTGCATCGGGAGCCAGG - Intergenic
1082689068 11:56277808-56277830 CTCTCTCTGCCTTGGCTGCCAGG + Intergenic
1083011350 11:59403008-59403030 TTCCCTCTTTTTTGGGATCCAGG + Intergenic
1083685898 11:64374892-64374914 CTGGCTCTTCCAGGGGAGCCAGG + Intergenic
1083744680 11:64728852-64728874 CTCCCTCTTACCTGGAGGCCTGG + Exonic
1084320989 11:68373312-68373334 CTCCCTGTCCCTTGGGGTCCCGG - Intronic
1085392447 11:76189377-76189399 CACCCTGTACCCTGGGAGCCAGG - Intronic
1085462670 11:76703745-76703767 CTCTCACATCCTTGGGAGCAAGG - Intergenic
1085584462 11:77688670-77688692 GTCCCTCCTACTTGGGAGGCTGG + Intronic
1087470868 11:98572466-98572488 CTCCCTCTCCCCTGGAAGCCAGG - Intergenic
1087828971 11:102798522-102798544 CACCCTCTGCCCTGGGAGCAAGG - Intergenic
1088296097 11:108296366-108296388 ATCCCTGCTCCTTGGGAGGCTGG - Intronic
1088721301 11:112594308-112594330 CTCCCTCTCCTTTGGGAGAGAGG - Intergenic
1088906425 11:114158588-114158610 ATCTCTCTTACTTGGGAGGCGGG + Intronic
1089056784 11:115592060-115592082 CTTACTTCTCCTTGGGAGCCAGG + Intergenic
1089295186 11:117463136-117463158 CTCCCTTTTGCTTGGGAGCAAGG - Intronic
1089565077 11:119366874-119366896 CTCCCTCTTCCCTGGGATTTAGG + Intronic
1091143990 11:133261320-133261342 CTCTCTCTTCCTTTAGAGACTGG + Intronic
1091878953 12:3960841-3960863 CTCCCTCTTCTTTCCCAGCCAGG + Intergenic
1092212058 12:6652763-6652785 CTCCCTCTTCCCTAGAAGGCCGG - Exonic
1093572269 12:20680193-20680215 CTTCTTCTTCCTTGATAGCCTGG - Exonic
1100348931 12:93760068-93760090 CTGCTTCTACCTTGGGACCCAGG - Intronic
1100565476 12:95790421-95790443 CTTCCTCCTCCTGGGGCGCCGGG + Exonic
1101331530 12:103761500-103761522 CTCCCTCTTCCTCCAGAGACTGG + Intronic
1101880479 12:108622679-108622701 CTCCATCTTCCTTGGGTACATGG + Intronic
1102316385 12:111891209-111891231 GTCCCAGTTCCTTGGGAGGCTGG - Intronic
1103887131 12:124210882-124210904 CTGCCTTCCCCTTGGGAGCCTGG + Intronic
1104475907 12:129070042-129070064 CGCCATCTTCCTTGGGAGTTTGG + Intergenic
1104953715 12:132453861-132453883 CTCCCTGGCCCTGGGGAGCCGGG + Intergenic
1105876121 13:24554837-24554859 CTCTCTCTGCCTTGGCTGCCAGG - Intergenic
1106446505 13:29837192-29837214 ATCCTTTTTCCTTGGGTGCCTGG - Intronic
1106656195 13:31749388-31749410 CTCCTTCTTCAGTGGTAGCCTGG + Intronic
1107664653 13:42676202-42676224 TTCCCTCTTCCTTGGCTGCCAGG + Intergenic
1107966416 13:45602219-45602241 CTCCCTTTTCCTCAGGAGGCTGG + Intronic
1109811665 13:67520561-67520583 GTCCCTCTTCCTGGGCACCCTGG - Intergenic
1110156438 13:72322466-72322488 TTCCCTCTTTCTTAGGAGCTGGG - Intergenic
1110360246 13:74616487-74616509 CACCCTCTTCCTTGGGACTGAGG - Intergenic
1111111122 13:83710980-83711002 GTCCCTGTTACTTGGGAGGCTGG + Intergenic
1111929757 13:94501557-94501579 CTTCCCCATCCTTGTGAGCCTGG - Intergenic
1112624712 13:101090939-101090961 CTCCCACTTCTGTGGGGGCCAGG + Intronic
1113641119 13:111957244-111957266 CTCCATCTTCCTTGGAGGCTGGG + Intergenic
1114206963 14:20581192-20581214 ATCCCTTTGCCTTGGGAGCAAGG + Intergenic
1114364229 14:22009955-22009977 CTCCCTCTTCCTCTGCTGCCCGG - Intergenic
1115269854 14:31539619-31539641 CTCCCTCTTTCTTTGGACCTAGG + Intronic
1115754031 14:36516217-36516239 CTCCCTCTTCCTGTGGGGCAAGG + Intergenic
1115892475 14:38046835-38046857 CTGCCTCTTCCTGGGATGCCTGG - Intergenic
1118996987 14:70845447-70845469 TCCCCTCTTCCTCAGGAGCCTGG - Intergenic
1119445770 14:74662123-74662145 CTCACTCATCCTTGGGGTCCGGG - Exonic
1119538535 14:75423020-75423042 CTCCCTCTTCCCTGTGGCCCTGG - Intergenic
1120272099 14:82326232-82326254 CTGCCTTTTCCTTAGGAGGCAGG + Intergenic
1121011828 14:90524355-90524377 CTCCCACTTCGCTGAGAGCCGGG - Intergenic
1121176182 14:91892363-91892385 CCCCCTGTTCCTTTGGAACCAGG + Intronic
1121631937 14:95427593-95427615 CTCTCTCTGCCTTGGCTGCCAGG + Intronic
1121718015 14:96089906-96089928 CTCCCCTGTCCTGGGGAGCCTGG - Exonic
1121941369 14:98074001-98074023 ACCCTGCTTCCTTGGGAGCCAGG - Intergenic
1122755981 14:103980392-103980414 CTCTCTCTGCCTTGGCTGCCAGG - Intronic
1122790670 14:104182961-104182983 CTGCTTCTTGCTGGGGAGCCTGG + Intergenic
1122910862 14:104826977-104826999 TTCCAGCTTCCCTGGGAGCCCGG - Intergenic
1202893516 14_KI270722v1_random:182353-182375 CTCTCTCTGCCTTGGCTGCCAGG + Intergenic
1124343369 15:28904232-28904254 CTCCCTGTTCCTGGGCACCCCGG + Intronic
1127673075 15:61214065-61214087 GTCTCAGTTCCTTGGGAGCCAGG - Intronic
1127735826 15:61838490-61838512 GTCCCTCCTCCTTGGCAGCTGGG + Intergenic
1127986050 15:64071433-64071455 CTCCCGCCTTCTTGGCAGCCAGG + Intronic
1128549204 15:68586868-68586890 CTCCCTCCTGCCTGAGAGCCAGG - Intronic
1128678358 15:69628242-69628264 TTCCCTGTTCCTTGAGATCCAGG + Intergenic
1129269020 15:74409800-74409822 CTGGCTCTGCCCTGGGAGCCCGG - Exonic
1129921107 15:79319777-79319799 CTCTCTCTGCCTTGGCTGCCAGG - Intronic
1130675321 15:85947125-85947147 CTTCCTCTGCCCTGGGAGCTTGG + Intergenic
1131379821 15:91954570-91954592 CTTCCTCTTCCTTCTGCGCCTGG - Intronic
1131462117 15:92624770-92624792 CTCCCTCTTGGTGGGGAGGCAGG + Intronic
1132309944 15:100849964-100849986 CTGCCTCTTCCCGGGGACCCGGG + Intergenic
1132990691 16:2791325-2791347 CTCCCTGTTCAGTGGGAGCTGGG + Intergenic
1133467217 16:6039178-6039200 CTTCCACTTCCCTGGAAGCCTGG + Intronic
1135141078 16:19922514-19922536 CTCCAGCTTCCATGGGAGACAGG + Intergenic
1135292919 16:21255585-21255607 CTCCCTTGCCCTTGGGATCCTGG + Intronic
1137678368 16:50315940-50315962 CTCCCTCTCCCTGGTGGGCCTGG + Exonic
1139266346 16:65642739-65642761 CTCCCTGCTCCTTGGGAGGATGG - Intergenic
1139315003 16:66060449-66060471 CTGCCTTTCCCTTGGAAGCCAGG - Intergenic
1140570890 16:76104867-76104889 CTCTCTCTGCCTTGGCTGCCAGG + Intergenic
1140718533 16:77749237-77749259 CATCCTCTTCCTTGTTAGCCGGG - Intergenic
1141080630 16:81048451-81048473 CTTCCTGTTCCTTTGGAGGCAGG - Intergenic
1142132899 16:88438882-88438904 CTCCCTTCTCCTTGGGACCTAGG - Exonic
1142290965 16:89193392-89193414 CTCCCACCTCCTTCGCAGCCCGG + Intronic
1142366011 16:89650064-89650086 CTCCATTCTCCCTGGGAGCCTGG + Intronic
1142368905 16:89666809-89666831 CTCTCTCTGCCTTGGCTGCCAGG - Intronic
1142415361 16:89938151-89938173 CTCTCTCTGCCTTGGCTGCCAGG - Intergenic
1142836784 17:2593568-2593590 CTCCCTCTTCCTGGCGGGTCTGG + Intronic
1142928974 17:3266353-3266375 CTCCCTCTTCTATGGGACTCTGG + Intergenic
1142960097 17:3547233-3547255 CTCCCTCTCCCTCAAGAGCCAGG - Intronic
1143527772 17:7482419-7482441 CACCCTCTGCCTTGAGAGCCAGG + Exonic
1143628778 17:8125467-8125489 CGCCCCCCTCCTTGGGAACCTGG + Intergenic
1143633019 17:8149522-8149544 CTCCCACATCCTGGGGAGCCAGG + Exonic
1143681524 17:8479573-8479595 CACCCTCTTGCTGGGGAGCTTGG - Intronic
1144777100 17:17790297-17790319 CTCCCTTTGCCTTGGGTTCCAGG + Intronic
1144873682 17:18385354-18385376 CACAAGCTTCCTTGGGAGCCTGG - Intronic
1144950024 17:18989059-18989081 CTCCCTGTCCCTTGGCAGCAAGG + Intronic
1145158783 17:20560427-20560449 CACAAGCTTCCTTGGGAGCCTGG + Intergenic
1145752840 17:27367592-27367614 CTCCCCCTACCTTGTCAGCCAGG - Intergenic
1145979322 17:29002538-29002560 CTCCAGCCTCCTTGGAAGCCCGG + Intronic
1146003255 17:29144301-29144323 CTCCCTCTTCCCAGCCAGCCTGG + Intronic
1146618166 17:34373213-34373235 CTCCCTCTTCTCTGAGTGCCAGG + Intergenic
1146706947 17:35007654-35007676 TTCCCTGCTCCTTGGGCGCCTGG + Exonic
1146730987 17:35193851-35193873 CACTCTCTGCCTTGAGAGCCAGG - Exonic
1146940315 17:36839685-36839707 CTCCCACTCCCATGGGTGCCAGG - Intergenic
1147132379 17:38417145-38417167 CTCCCTCCTCCCTGGCAGGCTGG - Intergenic
1148325186 17:46779310-46779332 CTCTATCCCCCTTGGGAGCCTGG - Intronic
1148346895 17:46909143-46909165 GTCCCAGTTACTTGGGAGCCCGG - Intergenic
1148401152 17:47362768-47362790 CTCTCTCTGCCTTGGCTGCCAGG + Intronic
1148774730 17:50088919-50088941 CTCCTTCTTCCTCTGGGGCCTGG + Intronic
1149497124 17:57126088-57126110 CTTCCTCTTCCTTCAAAGCCTGG - Intergenic
1149538181 17:57448627-57448649 CTCTACCTTCCTTGGGACCCAGG + Intronic
1150138254 17:62707499-62707521 TTCCCACTTCTTTGGGAGCCTGG - Intronic
1150586467 17:66522831-66522853 TGCCCTCTTCCTTTGGGGCCTGG - Intronic
1150764843 17:67994321-67994343 ATCCTTCTTCCTTTGGGGCCTGG - Intergenic
1150915673 17:69434367-69434389 CTCCCTCGTTCTTGGCAGGCAGG - Intronic
1152089077 17:78237131-78237153 CCCCCTCTGCCTGGGGAGGCTGG - Intronic
1152142397 17:78544472-78544494 CTCCCACTTGCAGGGGAGCCAGG - Intronic
1152224831 17:79087874-79087896 CTCCATCTTCCTTGCCTGCCTGG + Intronic
1152682508 17:81676455-81676477 CTCTCTCTGCCTTGGCTGCCAGG + Intergenic
1153163077 18:2230480-2230502 CTCTCTCTGCCTTGGCTGCCAGG - Intergenic
1153571305 18:6475935-6475957 CACCCTCTTCCTAGGGAGGGTGG + Intergenic
1154115513 18:11610030-11610052 CACCCTCTGCCTTGAGAGCCAGG + Intergenic
1154230224 18:12549755-12549777 ATCCTTCTTCCTAGGGAGGCGGG + Intronic
1155160259 18:23189750-23189772 CTGGCTCTTCCTTCTGAGCCTGG + Intronic
1156459003 18:37310857-37310879 CCCCCACTTCCTTGGGAGATGGG - Intronic
1157521328 18:48347558-48347580 CTGCCTCTGCCTTGGGCCCCTGG + Intronic
1157843556 18:50981527-50981549 TTCCCTTTTCCTTGGGAACAAGG - Intronic
1158699729 18:59735216-59735238 TTCCCTCTTCCTTGGGAGGCTGG - Intergenic
1158885683 18:61824901-61824923 CTCCCTCTTTCCAGGGAGCCTGG - Intronic
1159652074 18:70989056-70989078 TTTTCTCTTCCCTGGGAGCCTGG + Intergenic
1160772870 19:840891-840913 CTCCTTTTGCCTTGGGAGCCTGG - Intergenic
1161118545 19:2512703-2512725 CTCCCTCTGCCCTGGCAGCGGGG + Exonic
1161815727 19:6498733-6498755 CTCCCTCCTCCTCCCGAGCCTGG + Intronic
1163660274 19:18572893-18572915 CACCCTCTTCCACGGCAGCCAGG - Intronic
1163695534 19:18761587-18761609 CTCCTTCTTCCAGGGCAGCCAGG - Intronic
1163827570 19:19532291-19532313 TTCCCTCCGCCTTGGGAGCTGGG + Intronic
1163881805 19:19930186-19930208 CTCTCTCTGCCTTGGCTGCCAGG - Intronic
1163885172 19:19958972-19958994 CTCTCTCTGCCTTGGCTGCCAGG - Intergenic
1164063376 19:21694143-21694165 CTCCCTCTCCCTTGGCCCCCGGG - Intergenic
1164389066 19:27802111-27802133 CTCTCTCTGCCTTGGCTGCCAGG - Intergenic
1164434658 19:28218997-28219019 CTCCCTCTGCCGTGGGTGTCTGG - Intergenic
1164684553 19:30158242-30158264 TTCCCTCTTCCCTGGGGTCCAGG + Intergenic
1165445682 19:35855885-35855907 CTCCCGGTTCCTTGAGAGGCTGG - Intronic
1165774162 19:38395201-38395223 CCCCCTCTACCTTGAGATCCAGG - Intronic
1166142260 19:40811453-40811475 CTCCCTCTTCCTTCAGACCCAGG + Intronic
1166185263 19:41135341-41135363 CTCCCTCTTCCTTCAGACCCAGG - Intergenic
1166446815 19:42865229-42865251 CTCACTCTGCCTTGGTTGCCAGG - Intronic
1166466004 19:43031459-43031481 CTCTCTCTGCCTTGGCTGCCAGG - Intronic
1166472138 19:43087528-43087550 CTCTCTCTGCCTTGGCTGCCAGG - Intronic
1166485750 19:43210567-43210589 CTCTCTCTGCCTTGGCTGCCAGG - Intergenic
1166544450 19:43625810-43625832 CTCTCTCCTCCTTAGGACCCAGG + Intronic
1166546181 19:43635936-43635958 CCCCCTCCTCCTTGAGACCCAGG + Intronic
1166778728 19:45328437-45328459 CTTTCTCTTCCTGGAGAGCCAGG + Intergenic
1166995774 19:46719119-46719141 CTCCCTGCTCCTTGTGGGCCTGG + Intergenic
1167385010 19:49157941-49157963 CGCCCTCCTCTCTGGGAGCCTGG - Intronic
1167432574 19:49462815-49462837 CTCCCTCCTCCCTTGGACCCAGG - Intronic
1167460371 19:49621378-49621400 CCCCCTCCTCCTTCGGACCCAGG - Intronic
1167494867 19:49811749-49811771 CCCCCTCTTCCTTCAGACCCAGG - Intronic
1167495968 19:49818818-49818840 CTCCCTCCTCCCTCGGACCCAGG - Intronic
1167519062 19:49941588-49941610 CTCTCTCTGCCTTGGCTGCCAGG + Intronic
1167979131 19:53258293-53258315 CTCTCTCTGCCTTGGCTGCCAGG + Exonic
1168254289 19:55157410-55157432 CTTCCCCTTCCTTGGGTTCCAGG + Intronic
1168603423 19:57738901-57738923 CTCTCTCTGCCTTGGCTGCCAGG + Intronic
926305627 2:11635699-11635721 CACGCTCTTCCTTGGGCCCCTGG + Intronic
927242956 2:20934752-20934774 CTCCATCTTCTTGGGGACCCAGG + Intergenic
927576874 2:24207813-24207835 CACCCTCTCCCTTTGCAGCCAGG - Intronic
928071424 2:28221299-28221321 CACCCTCTTCCTTGGGACAGTGG + Intronic
928256803 2:29729674-29729696 CTGCCTCTGCCTTTAGAGCCAGG - Intronic
928700823 2:33896757-33896779 CTCCCTCTTCCCTAGTAGCTAGG - Intergenic
929768272 2:44869078-44869100 CTCCCTGTTCCTTGGGATTTAGG - Intergenic
930118698 2:47742078-47742100 CTCCCTCTGCCTTGGGATCAGGG + Intronic
930209332 2:48618009-48618031 CTCTCTCTTCCTTAGGGGCTGGG + Intronic
931629196 2:64284246-64284268 CTCCCTCTCCCATGGCATCCCGG - Intergenic
932593434 2:73080372-73080394 CTCCCTCCTCCTTGGTCTCCGGG + Intronic
933881477 2:86674121-86674143 CTTCCCCATCCTTGGCAGCCAGG - Intronic
933988359 2:87613055-87613077 CTCCTGCTTCCTGGTGAGCCTGG + Intergenic
936305482 2:111337753-111337775 CTCCTGCTTCCTGGTGAGCCTGG - Intergenic
936660520 2:114537903-114537925 CTCTCTCTTACTTGGAAGTCTGG + Intronic
937047472 2:118859318-118859340 CACCCTCTTCCTTGCGAGCCAGG - Intergenic
937102573 2:119283099-119283121 CTCCCTCTTCCTTGGTGGGAAGG + Intergenic
937223499 2:120355357-120355379 ATCCCTCCTCCTGGGCAGCCCGG - Intergenic
937304513 2:120862919-120862941 CTCCCTCCGACTGGGGAGCCAGG - Intronic
937868047 2:126768582-126768604 ATCCCCCTTCCTTGGGAGTTTGG - Intergenic
938303220 2:130230598-130230620 CTGCCTCTTCCTGTGGTGCCGGG + Intergenic
938453450 2:131443639-131443661 CTGCCTCTTCCTGTGGTGCCGGG - Intergenic
939344827 2:140950600-140950622 GTCCCACTTACTTGGGAGGCTGG - Intronic
939359442 2:141149636-141149658 CTCCTTCTTCCTTGGTAGTTTGG - Intronic
939731704 2:145792913-145792935 CCCCTACTTCCCTGGGAGCCAGG - Intergenic
940357138 2:152755579-152755601 CTCTCTCTGCCTTGGCTGCCAGG + Intronic
942226536 2:173821687-173821709 CTCCCTCTCCCCTGGCAGGCAGG + Intergenic
945920706 2:215752147-215752169 CTCCCTGTTCCTTGCGTGTCTGG + Intergenic
946620764 2:221560183-221560205 ATCCATCTTCCTTGGGGTCCGGG - Intronic
946870966 2:224084577-224084599 CTCTCTCTTCTTTGAGGGCCAGG + Intergenic
947497354 2:230647608-230647630 CTCCGTCTTGATTAGGAGCCGGG + Intergenic
947606578 2:231489828-231489850 CTCTCTCTGCCTTGGCTGCCAGG - Intergenic
948225926 2:236309390-236309412 ATGTCTCTTCCTTGGGACCCTGG - Intergenic
948397910 2:237661245-237661267 CTCCCTCTGCCTTGGAGGCTTGG + Intronic
948598892 2:239097005-239097027 CTCCCTTTGCCTGGGGGGCCTGG - Intronic
948887328 2:240890800-240890822 CTTCCCCTTCCTTGGCAGGCGGG + Intronic
949077628 2:242071048-242071070 CGATCTCTTCCATGGGAGCCAGG - Intergenic
1169000425 20:2164087-2164109 CTCCCTCATCCTGGGGAGGAGGG + Intronic
1171132804 20:22669746-22669768 CTAGCTCTTCCTTGAGACCCTGG - Intergenic
1171164929 20:22961297-22961319 CTCCCTTTTCCCTGGCAGGCTGG + Intergenic
1171967697 20:31542982-31543004 CGGCCTCTTCCTTAGGAGCTTGG - Intronic
1172098975 20:32474383-32474405 CTCCCTCATCTTTGGGAGGAAGG + Intronic
1172164835 20:32892767-32892789 TTCCCTCCTCCTTGGAAGCAAGG - Intronic
1172510593 20:35498113-35498135 CTCCCTTTCCCCTGGGAGCCAGG - Intronic
1172537743 20:35687432-35687454 CTCTCTCTGCCTTGGCTGCCAGG + Intronic
1173187172 20:40849095-40849117 CTACCCCTTCCTTGGGAGCAGGG - Intergenic
1174034954 20:47663208-47663230 CTCTCTCTTCCTTGGCAGTGGGG - Exonic
1174121961 20:48272490-48272512 CTCCCTCCTTCCTGGGTGCCTGG - Intergenic
1174781153 20:53390028-53390050 ATCCCTGTTCCTTTTGAGCCAGG + Intronic
1175143923 20:56881638-56881660 CACCCACTGCTTTGGGAGCCTGG + Intergenic
1175517878 20:59580240-59580262 CTGGTTCTTCCTTGGGTGCCGGG - Intronic
1176149363 20:63581450-63581472 CTCCCTCCTCCAGGGCAGCCAGG - Intergenic
1176195293 20:63834110-63834132 CCCCCTCTTCCTAGGGCCCCGGG + Intergenic
1176373699 21:6077112-6077134 CACCCTCTTCCTGGGAAGTCAGG - Intergenic
1177056807 21:16316512-16316534 CTCCCTCTTCTTTGGGATAAAGG + Intergenic
1177360655 21:20064765-20064787 CTCCCTCTACCATGTGAGGCAGG - Intergenic
1177996568 21:28107409-28107431 CTCCCTCTTCCATGGTATTCAGG - Intergenic
1179533812 21:42038615-42038637 CTCTCCCTTCCTTGGGTCCCCGG + Intergenic
1179749778 21:43461131-43461153 CACCCTCTTCCTGGGAAGTCAGG + Intergenic
1180612207 22:17105379-17105401 TTGCCTCCTCCTTGGGAGGCTGG - Intronic
1180707131 22:17816914-17816936 ATCCCCCATCCTGGGGAGCCAGG + Intronic
1180855186 22:19041032-19041054 TTCCCTCTCCCTGGGGAGTCAGG + Intronic
1180870591 22:19144569-19144591 CTCGCGCTTCCTCGGGGGCCTGG + Exonic
1181173914 22:21025488-21025510 CTCACTCTTCCCTGGGAACTGGG - Intronic
1181978385 22:26748937-26748959 CTCCCTCTCCCTGGGCAGCTAGG + Intergenic
1182350882 22:29698813-29698835 CTCCCTCTTCCTGGGGCACTTGG + Intergenic
1182558755 22:31142901-31142923 CTGCCTCTCCCTAGGGAGACAGG + Intergenic
1183202485 22:36395327-36395349 CTCCCTCTTCCCTGGCTCCCAGG + Intergenic
1183483061 22:38075357-38075379 CTCCCTCTGGCCGGGGAGCCGGG - Exonic
1183985720 22:41569101-41569123 CTCCCTCTCTCTAGGGAGCAGGG - Intronic
1184136289 22:42551812-42551834 CTCTCTCTGCCTTGGGTGCCAGG - Intergenic
1184649862 22:45914806-45914828 ATCCCTCTTTCCTGGGAACCAGG + Intergenic
1185050720 22:48552770-48552792 CCTCCTCTTCCCTGGGAGCCTGG - Intronic
949888400 3:8714134-8714156 CTCCCTCACCCTTGGAAGCCTGG - Intronic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
950401319 3:12771309-12771331 CTCTCTCTGCCTTGGCTGCCAGG + Intergenic
950762362 3:15243352-15243374 CTGCATCTTCATTTGGAGCCAGG - Intronic
952860274 3:37807056-37807078 CTCCCTCCTCCTTGGGGGCAAGG - Intronic
953294175 3:41696377-41696399 CTCTCTCTGCCTTGGCTGCCAGG + Intronic
953925843 3:46982058-46982080 CTTCCTCTTCCCAGGCAGCCTGG - Intronic
954706022 3:52480930-52480952 TCCCCTCTTCCGTGGGGGCCGGG - Intronic
954902901 3:54035141-54035163 ATCCTGCTTCCGTGGGAGCCAGG + Intergenic
955792752 3:62605506-62605528 CTCCCACTTAATTGGGAGCAAGG - Intronic
960138703 3:114131303-114131325 CCTCCTCTTTCTTGGAAGCCTGG + Exonic
960487212 3:118269223-118269245 CTACCTTCTCTTTGGGAGCCTGG - Intergenic
960622047 3:119646519-119646541 ATCCCTGTTACTTGGGAGGCTGG + Intronic
961223626 3:125219591-125219613 CCCCAACTTCCCTGGGAGCCAGG - Intergenic
962139222 3:132771158-132771180 CTCCCTCCTCCTTGGACCCCAGG - Intergenic
962197862 3:133379369-133379391 CTGCCTCTTCCTCTGCAGCCAGG - Intronic
962443355 3:135443665-135443687 CTATCTCTTCTTTGGGAGCTGGG + Intergenic
963931063 3:151004733-151004755 CTCCATCTGCCTTGAGAGCTGGG - Intergenic
966019344 3:175188652-175188674 ACCCCACTTCCTGGGGAGCCAGG - Intronic
966643891 3:182220936-182220958 CTCCCTATGGCTTGTGAGCCTGG + Intergenic
966913425 3:184571677-184571699 CTCCCTCCTCCCTGGGTCCCTGG + Intronic
968350935 3:198051371-198051393 CTCTCTCTGCCTTGGCTGCCAGG + Intergenic
968616995 4:1581710-1581732 ATCCCAGTTACTTGGGAGCCTGG - Intergenic
968745407 4:2357322-2357344 TCCCCTCTTCCTTGGGAGCGAGG - Intronic
968805258 4:2767851-2767873 CTCCCACGTCCTTGGGATGCTGG - Intergenic
969315636 4:6380033-6380055 CTCCCTCCTCCTTGGTTTCCTGG + Intronic
969337200 4:6518404-6518426 CTCCTTTTTCCTTGTTAGCCTGG - Intronic
969850754 4:9954568-9954590 CTCCCTCTTCCTCTGGATCTGGG + Intronic
970247510 4:14078845-14078867 CTCCCTCTGCATTCTGAGCCAGG + Intergenic
970473811 4:16402156-16402178 CTCACTCTTCCTGGAAAGCCTGG + Intergenic
971422026 4:26482082-26482104 CTCCAGCTTCCTCGGGGGCCTGG + Exonic
973563582 4:52161846-52161868 CTCCCACCTCCTCTGGAGCCTGG + Intergenic
974240059 4:59235502-59235524 CTCTCTCTGCCTTGGCTGCCAGG - Intergenic
976202744 4:82596010-82596032 TTCCCTCTTTCTTAGAAGCCAGG - Intergenic
976402103 4:84619091-84619113 ATCCCTCACCCTTGGGAGGCGGG - Intronic
977284930 4:95091574-95091596 GTCTCTCATCCTAGGGAGCCTGG + Intronic
977728084 4:100320863-100320885 CTCTCTCTTCCTTGAGAGGAAGG + Intergenic
984948066 4:184985368-184985390 CTCCCTCTCCCTGGGGACCTAGG - Intergenic
985686827 5:1285945-1285967 CTCCCTTCTGCTTGGGAACCAGG - Intronic
986241693 5:5965584-5965606 CTCTCTCTTCCTCAGGTGCCAGG + Intergenic
986387217 5:7246624-7246646 CTCCCCCTTCCATGGGGGTCAGG - Intergenic
987201172 5:15579793-15579815 CTCTCTCTTCCTAGGGTGTCAGG + Intronic
988482636 5:31642466-31642488 CTCCTTCTTCCCTTGCAGCCTGG - Intronic
992560732 5:77950280-77950302 CTGACTCTGCCTTGGCAGCCTGG + Intergenic
992752567 5:79874714-79874736 CAGCCTGTTCCTTGGAAGCCAGG + Intergenic
993983251 5:94568243-94568265 CTCCCTCACCATTGGCAGCCTGG + Intronic
994516178 5:100775347-100775369 CTCTCTCTGCCTTGGCTGCCAGG + Intergenic
996369983 5:122743088-122743110 CTCCCTGTTCCTTGGAAACAGGG + Intergenic
996574047 5:124962941-124962963 CTGCCTCTTCCTGTGGAACCTGG + Intergenic
996671044 5:126117937-126117959 CTCACTCCTGCTTCGGAGCCTGG - Intergenic
997007248 5:129832660-129832682 CTCCCTTCTCTTTGGGATCCTGG + Intergenic
997337018 5:133115626-133115648 CTCCCTGTCCCTTGAGGGCCAGG - Intergenic
1001546092 5:172571186-172571208 CTCCTTCCTCCCTAGGAGCCAGG - Intergenic
1001657707 5:173365251-173365273 CTCCCTCTTCCTTGCTAACAGGG + Intergenic
1002025756 5:176395278-176395300 CACTCTCTGCCTGGGGAGCCTGG - Intronic
1002643466 5:180641406-180641428 CTCCCTCTCCCTGGGGTGCTTGG + Intronic
1003653837 6:7987298-7987320 CTCGCTCTTTCTGGGAAGCCCGG - Intronic
1006054574 6:31373950-31373972 CTCTCTCTGCCTTGGCTGCCAGG - Intergenic
1006169556 6:32085308-32085330 ATACCTCGTCCCTGGGAGCCTGG - Intronic
1007708427 6:43805881-43805903 GTCCCTCCTCCTTGTGAACCAGG - Intergenic
1009505310 6:64469976-64469998 CTCTCTCTGCCTTGGCTGCCAGG + Intronic
1013589508 6:111608371-111608393 CTCTCTCTGCCTTGGCTGCCAGG + Intergenic
1015843005 6:137493317-137493339 CTCCCTCCTCCTTGGCAGCCGGG + Exonic
1015985061 6:138876207-138876229 CTCCCTCTTCCTTGGGAGCCAGG - Intronic
1018767840 6:166947713-166947735 ATCCCTCTTCCTAAGGAGCCAGG + Intronic
1019109364 6:169697697-169697719 CTCTCTCTGCCTTGGCTGCCAGG + Intronic
1019937889 7:4268285-4268307 CTCCCTCCTCCTGGGGTGCCAGG + Exonic
1020070483 7:5223816-5223838 GTCCCTCTGGCTTGGGTGCCAGG - Intronic
1020652138 7:10888799-10888821 CTCCCACTTACTTGGGATTCTGG - Intergenic
1022359124 7:29642390-29642412 CTCCCTCTCCCTTGGCCCCCAGG - Intergenic
1022552153 7:31251281-31251303 CTGCCTCTTCCGTGGGAGAGAGG + Intergenic
1023074324 7:36468027-36468049 CTCTCTCTGCCTTGGCTGCCAGG + Intergenic
1023827728 7:44020744-44020766 CTCTCTCTGCCTTGGCTGCCAGG + Intergenic
1024915387 7:54493180-54493202 CTCCCTCCTCCTTGGGAGCAGGG - Intergenic
1024971679 7:55077706-55077728 CCCGCTCTTCCATGAGAGCCTGG - Intronic
1026894890 7:74004262-74004284 CTTCCCCTTCCCTGGGTGCCTGG + Intergenic
1027114959 7:75471662-75471684 CTCCCACTCCCTTGGGTCCCAGG - Intronic
1027191719 7:76000516-76000538 CTCCCTGTACCTTGGGCGCAGGG - Intronic
1028511842 7:91633971-91633993 TTTCCTCCTCCTTAGGAGCCTGG - Intergenic
1029535378 7:101154662-101154684 CCCCCTCTTCCTCCCGAGCCCGG - Intronic
1031692408 7:124805180-124805202 CTCCCTCTTCGTTAGGTGTCTGG - Intergenic
1032019422 7:128398781-128398803 CTCCCTGTTCCTTGGGAAGAGGG - Intronic
1032384036 7:131509208-131509230 CTCCCTCTCCCTGGTTAGCCTGG - Intronic
1032982539 7:137300526-137300548 CTAACTCTTCCTTGGGAGGCAGG + Intronic
1034835546 7:154348824-154348846 CACCCTCTTCTCTGGTAGCCTGG + Intronic
1035912497 8:3583081-3583103 TGACCTCTTCCTGGGGAGCCTGG + Intronic
1036124671 8:6052009-6052031 CTGCCTCCACCGTGGGAGCCCGG + Intergenic
1036737547 8:11331541-11331563 CACCCTCTGCCTTGAGAGCCAGG + Exonic
1036791124 8:11720997-11721019 CTCCCCATTCCCTGTGAGCCTGG + Intronic
1036948286 8:13116208-13116230 CTCCATGTTCCTTGACAGCCTGG - Intronic
1037884458 8:22589084-22589106 CTGCCCCTTCCCTCGGAGCCAGG - Intronic
1037974923 8:23202258-23202280 CTCCCTCTTCCTCAGCAGGCTGG - Intronic
1038244580 8:25843460-25843482 CTCCCTCCGCTTTGGGTGCCTGG - Exonic
1042810770 8:72823039-72823061 CTTCCTCCTTCTTAGGAGCCAGG - Intronic
1047732009 8:127735967-127735989 CGCCCTCTGCTTTGGGAACCCGG - Intronic
1047944286 8:129859190-129859212 CTCTCTCTGCCTTGGCTGCCAGG - Intronic
1049326906 8:142026289-142026311 CTTTCTCTTCTTTGGGGGCCAGG + Intergenic
1049439045 8:142600937-142600959 CTCCCTCCACCGTGGCAGCCTGG - Intergenic
1049982465 9:916878-916900 CTCCCTCTTACCCGGAAGCCAGG + Exonic
1052719385 9:32155228-32155250 CTCTCTCTGCCTTGGCTGCCAGG + Intergenic
1053535175 9:38918498-38918520 ATTCCTTTTCCTTGGGATCCTGG - Intergenic
1054207399 9:62142903-62142925 ATTCCTTTTCCTTGGGATCCTGG - Intergenic
1054630954 9:67445451-67445473 ATTCCTTTTCCTTGGGATCCTGG + Intergenic
1055476272 9:76666539-76666561 CTCTCTCTGCCTTGGCTGCCAGG + Intronic
1055486373 9:76760147-76760169 CTTCCTCTTCCCTGGGTACCTGG + Intronic
1056846763 9:90045027-90045049 CTCCCTCTGCCCTGTGTGCCTGG + Intergenic
1057178102 9:93013986-93014008 CCACCTCTTCCTGGTGAGCCTGG + Exonic
1057886879 9:98836526-98836548 CTGCCTCTTCCTTAGGTGTCAGG + Intronic
1058757599 9:108097673-108097695 CTGCCTCTTCCTTGGGGGAATGG - Intergenic
1058763284 9:108157557-108157579 CTCTCCCTTCCTTGGTAGCAAGG + Intergenic
1060217378 9:121746509-121746531 TTCCCTCATCCTTGAGGGCCAGG - Intronic
1060487991 9:124061656-124061678 TTCCCTCTTCCTTGAGACCGTGG - Intergenic
1060940592 9:127540979-127541001 CTCCCTATGCCCTGGGAACCAGG - Intronic
1061594634 9:131620991-131621013 CTTCCTCTTCCTGGGGAGCATGG + Intronic
1062037366 9:134388775-134388797 CCTCCTCCTCCTTGTGAGCCAGG + Intronic
1062488877 9:136794805-136794827 CCCCCTCGTTCTTGGGGGCCAGG - Intronic
1062493798 9:136822151-136822173 CGCCCTCTGCGTTGGGAGCTTGG + Intronic
1062531788 9:137004850-137004872 CTCTCTCTGCCTTGGCTGCCAGG + Intergenic
1062532294 9:137007283-137007305 CGCCCACCTCCCTGGGAGCCGGG - Exonic
1186173825 X:6904554-6904576 TTCCCTCATCCTTCTGAGCCTGG - Intergenic
1186670809 X:11765452-11765474 CTCCATCTTCCCTAGGAGCCAGG + Exonic
1187252185 X:17608590-17608612 CTCCTTCTCCCTGGGAAGCCAGG - Intronic
1188212507 X:27442176-27442198 CTCTCTCTGCCTTGGCTGCCAGG - Intergenic
1190310485 X:49113891-49113913 CACCCTCTGCCTTGGGAACCAGG + Exonic
1191649101 X:63517772-63517794 CTATCTCTTCTTTGGGAGTCTGG - Intergenic
1191851737 X:65590433-65590455 CTCAGTCTTCCTTAGGGGCCAGG + Intronic
1192998744 X:76540530-76540552 CTCCCTCTGCTTTAGGAGCAGGG - Intergenic
1195646157 X:107232858-107232880 CTCCCATTTGCTTGGGAGGCTGG - Intronic
1199308254 X:146292777-146292799 CTCCCCCTTCGCTGGGAGCTTGG + Intergenic
1199671608 X:150152516-150152538 TTGCCTCCTCCTTGGGACCCAGG + Intergenic
1200151067 X:153951748-153951770 CTCGGTCTCACTTGGGAGCCAGG - Intronic
1201343891 Y:12961380-12961402 CTCTCTCTGCCTTGGCTGCCAGG - Intergenic
1201707601 Y:16954368-16954390 CTCTCTCTGCCTTGGCTGCCAGG + Intergenic