ID: 1015985347

View in Genome Browser
Species Human (GRCh38)
Location 6:138879053-138879075
Sequence GTGTTTCAGCAGCAGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 314}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015985347_1015985350 16 Left 1015985347 6:138879053-138879075 CCTCCTGCCTGCTGCTGAAACAC 0: 1
1: 0
2: 6
3: 36
4: 314
Right 1015985350 6:138879092-138879114 ACCTCCACTTCCAACTCTGCAGG 0: 1
1: 0
2: 3
3: 23
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015985347 Original CRISPR GTGTTTCAGCAGCAGGCAGG AGG (reversed) Intronic
900001517 1:17322-17344 TTGTTACAGCACCAGCCAGGGGG + Intergenic
900021236 1:187844-187866 TTGTTACAGCACCAGCCAGGGGG + Intergenic
900515937 1:3082284-3082306 GTTCTGCAGGAGCAGGCAGGAGG + Intronic
901007175 1:6177815-6177837 GTGTTCCAGAAGCAGCAAGGAGG + Intronic
902247939 1:15133988-15134010 TGGTCTCAGCAGCAGGAAGGCGG - Intergenic
902718700 1:18290235-18290257 GTGCTGCAGAAGCAGCCAGGTGG + Intronic
903537804 1:24078592-24078614 GCTTTTCCCCAGCAGGCAGGAGG - Intronic
904473134 1:30748091-30748113 CCGTCTCAGAAGCAGGCAGGCGG + Intronic
904594992 1:31638356-31638378 GTGTTGTAGCAGGAGGCAGGGGG - Intronic
904609779 1:31719205-31719227 GTGTTTGAGGAGCAGAGAGGAGG + Intergenic
904986104 1:34549970-34549992 GTGGTTCAGCAGCGGGGAGAAGG - Intergenic
905027991 1:34864567-34864589 GTGTGTCACCTCCAGGCAGGAGG - Intergenic
905627165 1:39496713-39496735 GTGTTTCACATGGAGGCAGGGGG - Intronic
906318486 1:44802871-44802893 CAGGTTCAGCAGCAGACAGGTGG + Intronic
906960191 1:50415505-50415527 GAGCTTCCGCAGCCGGCAGGAGG - Intergenic
907251327 1:53141735-53141757 GTGATTCTGGGGCAGGCAGGGGG - Intronic
907287428 1:53390793-53390815 GTATTCCAGCAGCAGCCTGGTGG - Intergenic
907569412 1:55468995-55469017 TGGTTTCTGCAGAAGGCAGGTGG + Intergenic
908067270 1:60420461-60420483 GTGTCTCAGCAGCAGGAAGGTGG + Intergenic
908283959 1:62573085-62573107 GTGTATCAGTAGCATGGAGGAGG + Intronic
911188799 1:94927550-94927572 GTGTTCCAGCAGCGGGCGGAGGG - Intergenic
911692222 1:100846976-100846998 GTGATTCAGCAGCAGAAAGAAGG - Intergenic
914923726 1:151865372-151865394 GAGTTGCAGCAGGAGGAAGGAGG - Intergenic
915580659 1:156811122-156811144 CTGTTTCGGCAGCAGGGTGGAGG - Intronic
915594116 1:156886778-156886800 GTGCTGGAGGAGCAGGCAGGAGG - Intergenic
917622986 1:176817115-176817137 GTGTTTGGGGAGCAGGCAAGAGG + Intronic
918259486 1:182782621-182782643 GTGTGTCTGCATTAGGCAGGTGG + Intergenic
918552934 1:185764989-185765011 GTGGTGCAGCAGGATGCAGGAGG - Intronic
919280897 1:195486555-195486577 GTTTGTCAACAGGAGGCAGGTGG + Intergenic
919874601 1:201854335-201854357 GTGATTCAGAAGCAGTTAGGAGG + Intronic
920964288 1:210689380-210689402 GGGTCTCAGCAGCACGCATGGGG + Intronic
921333291 1:214062037-214062059 GTGTTTCAGCAACAGTAAGGAGG - Intergenic
922471784 1:225881675-225881697 GTCATTCAGCCCCAGGCAGGTGG - Intronic
922743594 1:228030677-228030699 GTGTTTGAGAAGCAGCCAAGAGG - Intronic
922756408 1:228099516-228099538 GGGGTTCAGCAGCAGGCCGATGG - Intergenic
924783764 1:247175502-247175524 GTGTTCCAGCAGCAGACAGGAGG + Intergenic
1064634028 10:17345529-17345551 CTGTTTGAGAAGCAGGAAGGAGG + Intronic
1066055050 10:31673167-31673189 GTGTCTCAGGAGCAGGCATGAGG + Intergenic
1067096432 10:43304324-43304346 GTGTTAAAGCATCAGGTAGGGGG + Intergenic
1068007249 10:51406170-51406192 GTTCTGCAGCAGCAGGCAGTGGG - Intronic
1069123273 10:64596501-64596523 GGGTACCAGCAGCAGTCAGGCGG + Intergenic
1069718439 10:70535200-70535222 GTCTTTCAGAAGCAGCCAGCTGG - Intronic
1069883527 10:71609088-71609110 GAGATTTGGCAGCAGGCAGGAGG + Intronic
1071462411 10:85911505-85911527 GTGGGTCAGCAGCGGCCAGGAGG - Intronic
1072195356 10:93113206-93113228 GTGTGTCTGCAGCAGGCAATAGG + Intergenic
1072588405 10:96803442-96803464 TTGTCTGTGCAGCAGGCAGGAGG + Intergenic
1073350073 10:102813258-102813280 GGTGTTCAGCAGCAGGCATGCGG - Exonic
1073622322 10:105062228-105062250 GTTTTTAAGAAGCATGCAGGTGG + Intronic
1073874962 10:107912408-107912430 CTGTTTCAGCATCATGAAGGAGG - Intergenic
1073994972 10:109305041-109305063 TTGTTTATGCAGCAGGCAGGAGG + Intergenic
1074228708 10:111512862-111512884 CTGTATCAGAAGCAAGCAGGAGG - Intergenic
1074298087 10:112209587-112209609 ATGAAGCAGCAGCAGGCAGGAGG - Intronic
1074944513 10:118268352-118268374 GTGTTTGAGCAACATGCAAGAGG - Intergenic
1075866861 10:125729997-125730019 GTGTGTGAGGAGCAGGCAGTAGG + Intronic
1075896563 10:126001464-126001486 GGGACTCAGCAGCAGGCAAGCGG + Intronic
1076368925 10:129939426-129939448 GTGTTTCAGCTGATGGCAGTGGG - Intronic
1077166346 11:1141161-1141183 GTGTTTCAACACCAGGGATGGGG - Intergenic
1077265736 11:1648621-1648643 GGGCATCAGCAGCAGGCAGGAGG - Intergenic
1077939318 11:6823782-6823804 GGGATTGAGCAGGAGGCAGGAGG + Intergenic
1078413628 11:11147781-11147803 ATGTTTCAACAGCAAGCAGACGG - Intergenic
1080763670 11:35276472-35276494 GTGTGTCAGCAGAAGGGAGTTGG - Intronic
1082643619 11:55694169-55694191 GATTTTCAGCAGCAACCAGGAGG + Intergenic
1083679298 11:64343888-64343910 GTGCTTCAGGGGCAGCCAGGGGG + Exonic
1084224835 11:67709686-67709708 GTGTGCCAGGAGCAGCCAGGTGG + Intergenic
1084262654 11:67989529-67989551 GTGTGCCAGGAGCAGCCAGGTGG + Intergenic
1085390761 11:76180975-76180997 GAGTGGGAGCAGCAGGCAGGAGG - Intergenic
1085516094 11:77112800-77112822 AGGTGCCAGCAGCAGGCAGGTGG + Intronic
1085780626 11:79405042-79405064 GTGTTTATGCAACAGGCAGAGGG + Intronic
1086246942 11:84764209-84764231 GTGTGGCAGCTGGAGGCAGGTGG + Intronic
1086721489 11:90127152-90127174 GGTTTTCAGGAGCAGGAAGGAGG - Intergenic
1086970223 11:93073346-93073368 TTGTTTGTGCAGCAGTCAGGAGG + Intergenic
1087212655 11:95459414-95459436 GTTTTTCAGGAGGTGGCAGGAGG - Intergenic
1088742766 11:112780483-112780505 GTATGTCAGCTGCAGGGAGGTGG + Intergenic
1088834128 11:113562980-113563002 GTCTTTCAGGAGATGGCAGGAGG - Intergenic
1089176390 11:116551863-116551885 GTGTTTCACCGGCAGCCAGCTGG + Intergenic
1089419400 11:118319859-118319881 GTGTTTAAGGAGCAGGGAGGAGG - Intergenic
1089725800 11:120478573-120478595 GTGATTCTGAACCAGGCAGGGGG - Intronic
1089852875 11:121515498-121515520 GTGTTTTAGGAGCAGGGAGGAGG + Intronic
1090356867 11:126146420-126146442 GAGTTCCAGCAGGAAGCAGGGGG + Intergenic
1090988675 11:131796298-131796320 GTGTCTCAGGAGCACGCAGGAGG + Intronic
1091242260 11:134061555-134061577 GTGTTACAGAAGCACACAGGAGG + Intergenic
1091374602 12:17437-17459 TTGTTACAGCACCAGCCAGGGGG + Intergenic
1091824116 12:3497200-3497222 GTGTGTGAGAAGCAAGCAGGTGG + Intronic
1091896946 12:4113170-4113192 CTGTTTAAGCAGCAGGCAGGGGG - Intergenic
1097836125 12:64274226-64274248 GTGATGCAGCTGCAGGGAGGGGG + Intronic
1098084995 12:66833123-66833145 TTGTGGCAGCAGCAGGGAGGTGG - Intergenic
1098252356 12:68583432-68583454 GGGATTCAACAGCAGGGAGGAGG + Intergenic
1099017715 12:77364646-77364668 GAGTTAAAGCAGCAGGCTGGAGG + Intergenic
1099806718 12:87529577-87529599 GTATTGCAGCAGCTGGCAGTAGG - Intergenic
1102471662 12:113162998-113163020 GCCTTTGAGCAGCAGGCAGCTGG - Exonic
1102536200 12:113583305-113583327 TGTTTTCAGCAGCAGGGAGGTGG + Intergenic
1102783233 12:115583674-115583696 GTGTTTCAGCAGAAGGAAAGTGG - Intergenic
1103180917 12:118910607-118910629 GTTTTTCAGCAGAAGGCAGGTGG + Intergenic
1104260165 12:127174890-127174912 TTGATTAAGCAGCAGGCACGGGG + Intergenic
1104327351 12:127812054-127812076 TGCTTTCAGCAGCAGGCAGTTGG - Intergenic
1104952063 12:132445595-132445617 GTGTTTGGGGAGCTGGCAGGTGG - Intergenic
1106464979 13:30005386-30005408 ATGTTCCAGCAGCAGCCAGATGG + Intergenic
1106552545 13:30784698-30784720 GTGTTTGAGAAGCAGAAAGGGGG + Intergenic
1109351989 13:61194617-61194639 TTGTTTCAGCAGTAGGGAGAAGG - Intergenic
1111703560 13:91720578-91720600 GGTTTTCAACAGCAGGCAGTTGG - Intronic
1111948679 13:94692319-94692341 GTGTTTGAGCAGCAGCAAGAAGG + Intergenic
1115597219 14:34920975-34920997 GTGTTCCACCAGCAGATAGGAGG + Intergenic
1116659110 14:47685068-47685090 GTGTGTCAGCAGCAGGTAGGGGG - Intergenic
1117030201 14:51660927-51660949 GTGTTCCAGGAGCAGGGAGAAGG + Intronic
1119375926 14:74192795-74192817 ATGTTCCAGCAGCAGACAGGAGG + Intronic
1121225949 14:92322405-92322427 GTGATACAGGTGCAGGCAGGTGG - Intergenic
1121439418 14:93939426-93939448 GTGTTGCAGCAGCAGCTCGGTGG + Exonic
1121927709 14:97944063-97944085 GTGTTTCACCAGAAGCCAGTTGG - Intronic
1122647430 14:103204556-103204578 CTGATTCAGCACCAGGCAGAGGG + Intergenic
1122819888 14:104336210-104336232 GTGTTTCTGAAGCTGGAAGGGGG + Intergenic
1123472268 15:20564251-20564273 GTGTTCCAGCAGGAGCCAAGAGG + Intergenic
1123482292 15:20643300-20643322 TTGTCTGTGCAGCAGGCAGGGGG - Intergenic
1123645735 15:22436102-22436124 GTGTTCCAGCAGGAGCCAAGAGG - Intergenic
1123732573 15:23159242-23159264 GTGTTCCAGCAGGAGCCAAGAGG + Intergenic
1123750706 15:23356622-23356644 GTGTTCCAGCAGGAGCCAAGAGG + Exonic
1124283077 15:28380538-28380560 GTGTTCCAGCAGGAGCCAAGAGG + Exonic
1124299622 15:28531075-28531097 GTGTTCCAGCAGGAGCCAAGAGG - Exonic
1124687049 15:31791732-31791754 ATGTTTCAGAAGGAGGGAGGGGG - Intronic
1124960178 15:34387899-34387921 GTGTTCCAGCAGCAGCGAAGAGG - Exonic
1124976807 15:34534120-34534142 GTGTTCCAGCAGCAGCGAAGAGG - Exonic
1125277690 15:38010542-38010564 GAATGTCAGCAGCTGGCAGGGGG + Intergenic
1126319317 15:47405208-47405230 GTGTGTTAGTAGCAGGGAGGAGG + Intronic
1127561691 15:60144758-60144780 TTGTTTTAGCAGCATGCAGTTGG + Intergenic
1128452073 15:67811521-67811543 GAGTTTGGGCAGCAGTCAGGGGG - Intergenic
1128987601 15:72232313-72232335 GTGATTCAGCTGCAGGCAGCGGG - Intergenic
1131008609 15:88999052-88999074 GTCTTTATGCAGCAGGCAGGAGG - Intergenic
1131855116 15:96585446-96585468 GAATTTCAGCATCAGGCCGGGGG + Intergenic
1132451993 15:101973616-101973638 TTGTTACAGCACCAGCCAGGGGG - Intergenic
1132454902 16:17005-17027 TTGTTACAGCACCAGCCAGGGGG + Exonic
1132597489 16:760054-760076 GGGTTTCAGGGGCAGGGAGGGGG + Intronic
1132866347 16:2094437-2094459 GTTTATCAGCAGCAAGCGGGCGG - Intronic
1132941188 16:2509145-2509167 GCGTTTCTTCTGCAGGCAGGTGG - Intronic
1133360906 16:5173188-5173210 GGGTCTCTGCACCAGGCAGGAGG + Intergenic
1133658349 16:7889169-7889191 GTGTAACAGCAGCAGGGATGAGG + Intergenic
1133874046 16:9716482-9716504 GTGTTTGAGGAACAGGCAGGAGG + Intergenic
1134022520 16:10930880-10930902 GTGTCTCAGGAGCAGGCTGGTGG - Exonic
1134335565 16:13296407-13296429 GTTTTTGAACAGCACGCAGGGGG + Intergenic
1135842818 16:25892238-25892260 GTGTTTTAGGGGCAGGCATGCGG + Intronic
1136672449 16:31870904-31870926 GTGTTCCAGAAGCAGACAGGAGG - Intergenic
1137364485 16:47848931-47848953 GTGTCTCTGCAGCAGGGAGCAGG - Intergenic
1137709927 16:50559563-50559585 GTGGTGCAGCAGCAGGGAGTGGG + Intronic
1138159594 16:54740919-54740941 GTGTGTCAACTGCAGTCAGGTGG + Intergenic
1138470794 16:57234151-57234173 GTGTTTCAGGAGCAGCAAGGAGG - Intronic
1138527641 16:57618251-57618273 GTGTTTAAGGAGCAAGGAGGAGG - Intronic
1138589413 16:57991597-57991619 GCTCTTCAGCAGCAGGCAGACGG - Intergenic
1139130133 16:64133050-64133072 ATATTTCAGATGCAGGCAGGAGG + Intergenic
1139517693 16:67461467-67461489 GGGTCTCAGGAGCAGGTAGGAGG + Intronic
1139777626 16:69326490-69326512 GTGTTTAAGCAGTAGGAATGAGG - Exonic
1140057388 16:71537234-71537256 GTCTTTCAGCAGCGGGTAGAGGG - Exonic
1140802411 16:78500539-78500561 GTGTTCCAGCAGCATGCACCTGG - Intronic
1140818034 16:78638632-78638654 GTGCCCCAGCAGCAGGCTGGAGG + Intronic
1141160635 16:81627373-81627395 TTGTTTGTGCAGCAGGCAGAAGG + Intronic
1141863990 16:86737192-86737214 GTGTGTCTGCCGCATGCAGGGGG + Intergenic
1144833343 17:18143797-18143819 GTGGGTCAGCACCAGGCGGGGGG + Intronic
1145754618 17:27381382-27381404 GTATCTCACCAGCCGGCAGGAGG + Intergenic
1146365816 17:32226836-32226858 TTGGTTCAGAAGAAGGCAGGGGG + Intronic
1146664190 17:34685914-34685936 GTGTTTCGGATGCAGGCAGCCGG + Intergenic
1146949400 17:36895170-36895192 GTGTTTCAGGAAGGGGCAGGAGG - Intergenic
1147436136 17:40417428-40417450 GTTTTCAAGCAGCGGGCAGGAGG + Intronic
1147582858 17:41636777-41636799 GTGCTTGAGCAGCGGGCAGTCGG + Intergenic
1147957951 17:44147973-44147995 GTGTAACAGCAGCAGCCTGGAGG - Exonic
1148231745 17:45940252-45940274 GTGTTTAAGCCAAAGGCAGGAGG - Intronic
1148598329 17:48874915-48874937 GTGTTCCAACAGCAGACGGGAGG - Intergenic
1149313422 17:55418000-55418022 GTGTTTAAGGAGCAGAAAGGAGG - Intronic
1149786621 17:59440927-59440949 GTCTTTCTACAACAGGCAGGCGG - Intergenic
1151610164 17:75168349-75168371 GTGTTCCAACAGCAGACGGGAGG - Intergenic
1152900108 17:82936217-82936239 GAGAATCAGCAGCTGGCAGGCGG - Intronic
1153694096 18:7622727-7622749 CAGTTTCAGCATCAGGCAGCAGG + Intronic
1156014350 18:32531229-32531251 GTGTTTTAGAAGTAGGCTGGGGG + Intergenic
1156366130 18:36428966-36428988 ATGTTTTAGCAGCAGTCAGTCGG + Intronic
1160556264 18:79727301-79727323 GTGTTTCAGCCAAATGCAGGTGG + Intronic
1160563185 18:79771661-79771683 GTGTCTGTGAAGCAGGCAGGCGG - Intergenic
1161125850 19:2556702-2556724 GGGTCTCAGCTGCAGGAAGGCGG + Intronic
1162155747 19:8677128-8677150 GTGCTTCAGCCCCAGGCCGGGGG - Intergenic
1162312616 19:9915930-9915952 GTGTTTGAGGACCAGGAAGGAGG + Intronic
1162463577 19:10827964-10827986 GTGTTTGAACAGAAGCCAGGTGG + Intronic
1163029941 19:14537368-14537390 CTGTTTCAGCCGCACCCAGGTGG + Intronic
1163625285 19:18386061-18386083 GTGTTTACTCTGCAGGCAGGGGG + Intronic
1163853390 19:19680255-19680277 GTGCTTTGGCAGGAGGCAGGGGG + Exonic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1164875681 19:31685144-31685166 ATGTTTCAGCAGCTGACAGGAGG - Intergenic
1165787895 19:38473408-38473430 GTGGGTCAGGCGCAGGCAGGGGG - Exonic
1166240908 19:41493046-41493068 GAGGTGGAGCAGCAGGCAGGAGG + Intergenic
1166317137 19:41995631-41995653 GTGTGTCGGCAGCAGGCCTGGGG - Intronic
1167087554 19:47320595-47320617 CTTCTTCAGCAGCAGGAAGGTGG - Exonic
1167114077 19:47478880-47478902 GAGATTCAGAAGCAGGAAGGTGG + Intronic
1167470354 19:49672315-49672337 GTGTTTGAGGAGCAGGGAGGAGG + Intronic
1168273236 19:55261761-55261783 GTGTCTCAGGAGCAGGCCTGTGG - Intergenic
925339661 2:3127337-3127359 GTGTTTCAGCATCTGTCACGGGG - Intergenic
925796848 2:7554857-7554879 GTGCTTCAGCTGCTGGCAGAAGG - Intergenic
926003781 2:9355454-9355476 GTGTGTGTGCAGCAGGGAGGCGG - Intronic
926994638 2:18721268-18721290 GTGGTGCAGGAGGAGGCAGGGGG - Intergenic
927444614 2:23148064-23148086 GAGTTTAAGCAGCAGACAGAAGG - Intergenic
927922971 2:26987830-26987852 GTGTTTCACAAGCATGTAGGAGG - Intronic
931517756 2:63059726-63059748 GGGTTTCAGCACCTGGCGGGAGG - Intergenic
932112572 2:69013907-69013929 GTGTCCCAGGAGCAGGCAAGGGG + Intronic
932176064 2:69603833-69603855 GTGTTTCAGGAGTTGGCAGCAGG + Intronic
932485431 2:72081635-72081657 GTGTGTGACCCGCAGGCAGGGGG + Intergenic
932612500 2:73210251-73210273 GTGTTTGAGGACCAGGAAGGAGG - Intronic
933464900 2:82639701-82639723 GGGTCTCAGAAGAAGGCAGGAGG + Intergenic
933947751 2:87301494-87301516 GTGTTTCAGGGGCAGAAAGGAGG + Intergenic
936332451 2:111560079-111560101 GTGTTTCAGGGGCAGAAAGGAGG - Intergenic
936568208 2:113596092-113596114 TTGTTACAGCACCAGCCAGGGGG - Intergenic
936783354 2:116061835-116061857 GTATTTCAACAGCAGGCTAGAGG - Intergenic
938451868 2:131428210-131428232 GTGTTTTAGCAGAAGGAAGTTGG + Intergenic
938702560 2:133892699-133892721 AAGTCTCAGCAGAAGGCAGGTGG + Intergenic
939529279 2:143337004-143337026 GTGTTTCAGGAGGTGGAAGGGGG + Intronic
942571830 2:177322902-177322924 CTGCTTCAGCAGGAGGAAGGAGG + Intronic
942913482 2:181274524-181274546 GTGTTAGAACACCAGGCAGGTGG + Intergenic
946455492 2:219822382-219822404 GTGTTTACCCAGCAGGCACGTGG - Intergenic
947825866 2:233105662-233105684 GTGGTGCAGCAGCCAGCAGGCGG - Intronic
948213923 2:236214924-236214946 ATTTTGCAGCAGCAGGCCGGGGG - Intronic
948259302 2:236591042-236591064 CTGTCTGAGCAGGAGGCAGGAGG - Intergenic
948266868 2:236641328-236641350 GGGCTTCAGCAGTGGGCAGGCGG + Intergenic
948786074 2:240353623-240353645 CTGTTTGAGCAGCATGCGGGAGG - Intergenic
1169566109 20:6855244-6855266 GTGGTGAAGAAGCAGGCAGGAGG + Intergenic
1170472729 20:16684379-16684401 GTCTTTCAACACAAGGCAGGTGG + Intergenic
1172096707 20:32463999-32464021 CTGTCACAGCAGCAGCCAGGCGG + Intronic
1172160389 20:32863919-32863941 GTGTTTCTGCATCGGGGAGGGGG + Intronic
1172829125 20:37817480-37817502 GAGTTTCAGTAGCAGGGTGGTGG + Intronic
1173441665 20:43082920-43082942 GTGGGTCAGCAGGAAGCAGGTGG - Intronic
1173621163 20:44437047-44437069 GTTTTTCAGCTGCAGCCAGGTGG + Intergenic
1173747081 20:45445947-45445969 GTGTTTGAGCAGCAGCGATGAGG + Intergenic
1174168902 20:48604258-48604280 GGGCTTCTGCAGGAGGCAGGAGG + Intergenic
1174416965 20:50373850-50373872 GTGTTCCAGGAGCAGGGAGGAGG + Intergenic
1175119320 20:56706190-56706212 GTGTTATAGGAGCAGGGAGGAGG + Intergenic
1175322661 20:58100330-58100352 ATGTTTCAGCAGGAGACAGCCGG - Intergenic
1175785931 20:61711853-61711875 GTATTCCAGCTGCAGGGAGGAGG + Intronic
1175867919 20:62191241-62191263 GTGTGGCAGCTGCAGGCAGCCGG + Intronic
1176043846 20:63082452-63082474 GGGCTTCAGCACCAGGGAGGCGG + Intergenic
1176172762 20:63703574-63703596 TTGTGTCAGCAGCAGACAGCCGG - Intronic
1176215787 20:63947098-63947120 GTGGCCCAGCTGCAGGCAGGAGG - Intronic
1179165387 21:38931642-38931664 GCTTTGCAGCGGCAGGCAGGTGG - Intergenic
1179727824 21:43350243-43350265 GTGGTCCAGCATCTGGCAGGAGG + Intergenic
1179966118 21:44806988-44807010 GTGTTCCAGCAGCAGACGGGAGG - Exonic
1180045400 21:45302833-45302855 GGGCTCCAGCAGCAGCCAGGCGG - Intergenic
1180082507 21:45493318-45493340 GTGTCACAGCAGCAGCCGGGGGG - Intronic
1181845044 22:25700040-25700062 GTGTTTCAGCAGAAGCAAGGGGG - Intronic
1184806894 22:46800869-46800891 GGTTTCCAGCAGTAGGCAGGTGG + Intronic
1185314724 22:50174130-50174152 GGGTTTGGCCAGCAGGCAGGAGG + Intronic
950094372 3:10320273-10320295 GTGTCTCAGCAGCAGGTTTGAGG - Intronic
950424749 3:12919114-12919136 GTGTCCAAGCAGCAGCCAGGAGG - Intronic
952414426 3:33077459-33077481 ATGTTCCAACAGCAGTCAGGGGG + Intronic
952690227 3:36196703-36196725 GTGTTTCATCTGCAGGAAGTAGG - Intergenic
954039054 3:47870638-47870660 GTGCCCCAGCAGCAGGGAGGCGG - Intronic
956225020 3:66947673-66947695 GTGTTTCAGGAGCTGCAAGGAGG - Intergenic
957078087 3:75617471-75617493 GTGTGCCAGGAGCAGCCAGGTGG + Intergenic
958485670 3:94704500-94704522 GTTTTTCAGAACAAGGCAGGCGG + Intergenic
959273324 3:104242279-104242301 AAATTTCAGCAGCAGGCAGATGG - Intergenic
959696588 3:109254966-109254988 TTGTTTAATCAGCAGTCAGGAGG - Intergenic
959933886 3:112010586-112010608 GTATTTCAGAAGCAGACAGAAGG - Intronic
960968136 3:123119751-123119773 GTGTTTCAGCAGCGAGGAGGGGG - Intronic
961141369 3:124559348-124559370 GTGACTCAGCAGCAGGCACTTGG + Intronic
962566824 3:136669211-136669233 GTGTGTTAGAAGCAGGCAAGTGG - Intronic
963810812 3:149774541-149774563 CTCATTCAGCAGTAGGCAGGAGG - Intronic
963931049 3:151004653-151004675 GACTTTCAGCAGCAGGTTGGAGG + Intergenic
968035043 3:195541367-195541389 GGTTTTCAGCAGCAGGAATGTGG - Intronic
968808973 4:2791724-2791746 GTGTCTCTCCAGCAGGGAGGAGG + Intergenic
969732699 4:8965976-8965998 GTGTGCCAGGAGCAGCCAGGTGG - Intergenic
974578689 4:63765492-63765514 GTGTTTCAGAAGAATGTAGGTGG + Intergenic
974691732 4:65305624-65305646 TTGGTCCAGCAGCTGGCAGGAGG - Intergenic
975233036 4:71957021-71957043 GAGTTGCAGGAGCAGCCAGGTGG - Intergenic
977181325 4:93878830-93878852 GAGTTGCAACAGCAGTCAGGAGG - Intergenic
978549889 4:109914231-109914253 GTGTCTAAGCAGCAGGTTGGAGG - Intronic
978759672 4:112343126-112343148 GTGTTTAATGTGCAGGCAGGAGG - Intronic
982394528 4:154901857-154901879 GTGTTCCAGGACCAGGAAGGAGG - Intergenic
985109570 4:186534964-186534986 GTGCTTCAGCAGCTCTCAGGGGG + Intronic
986332444 5:6727340-6727362 GCGTCTCAGCAGGAGGCAGTGGG + Intronic
986493718 5:8320291-8320313 GCCTTTCAGGAGGAGGCAGGTGG - Intergenic
987066698 5:14296982-14297004 GTGTTTCAGCAGGTGGCATCTGG + Intronic
987853549 5:23388046-23388068 GCTTTGCAGCACCAGGCAGGCGG + Intergenic
990396968 5:55392004-55392026 GTCTTACTGCAGCAGGCAAGCGG + Intronic
990821798 5:59849127-59849149 GTCTTTTTGCAGTAGGCAGGTGG + Intronic
996015350 5:118527924-118527946 GTGTTTGAGTAGTAGACAGGTGG - Intergenic
998334051 5:141355303-141355325 GTGTTTGAGGAGCAGGAAGAAGG + Exonic
998351399 5:141504352-141504374 GTGCTTCAGTAGGAAGCAGGTGG + Intronic
998471822 5:142389640-142389662 GTGTTTGAGCAACAGTGAGGAGG + Intergenic
998631081 5:143899322-143899344 GGGTTCCAGCAGAATGCAGGAGG + Intergenic
999500533 5:152142592-152142614 ATATTTCAGCACCCGGCAGGCGG + Intergenic
999859808 5:155633413-155633435 GAGTTTCAGCTGCATCCAGGAGG - Intergenic
1000338320 5:160258269-160258291 CTGTTGCAGCATCAGGCAAGTGG + Intronic
1002802126 6:533669-533691 TTGTCTCACCAGCAGGCAGGAGG + Intronic
1004073058 6:12319559-12319581 GTGCTCCAGCAGCACGCAGGAGG + Intergenic
1004514013 6:16306647-16306669 GTGCTTCAGCAGGACGCTGGCGG + Exonic
1004604765 6:17183553-17183575 TTGTCTGTGCAGCAGGCAGGAGG + Intergenic
1005083437 6:21980492-21980514 GTGGTTCAGGAGCAGGGAGGAGG - Intergenic
1005709107 6:28486493-28486515 GTGTCTAGGCAGCAGGCAAGGGG - Intergenic
1005826671 6:29636070-29636092 GTGTTCCAACAGCAGACGGGAGG - Intergenic
1006448534 6:34092868-34092890 GTGTATCTACAGGAGGCAGGGGG - Intronic
1007445892 6:41905692-41905714 ATATTTCTGCAGCAGGCATGGGG + Exonic
1008020213 6:46567905-46567927 GAGTTTCAGCAGTTGCCAGGTGG + Intronic
1008413431 6:51210986-51211008 GTGTTGCAGAAGCAAGCAGGTGG + Intergenic
1010340246 6:74741849-74741871 GAGTTCCAGCAGAAGGCCGGAGG - Intergenic
1010519018 6:76810081-76810103 GGAGTTCAGCAGCGGGCAGGCGG + Intergenic
1013534086 6:111047453-111047475 GTATTGCAGGAGCAGGCAGACGG + Intergenic
1013671952 6:112413888-112413910 GGGTTTCAGCAGGAGACAGATGG + Intergenic
1014441623 6:121480229-121480251 GTGTTTCCGCAGGAGGAAGTCGG - Intergenic
1014934774 6:127374557-127374579 GTCTTTGTGCAGGAGGCAGGAGG + Intergenic
1015985347 6:138879053-138879075 GTGTTTCAGCAGCAGGCAGGAGG - Intronic
1016091031 6:139979566-139979588 GTGTGTCGGCTGCAGCCAGGCGG + Intergenic
1018604535 6:165583677-165583699 AAGTCTCAGCAGCAGGTAGGTGG + Intronic
1019212891 6:170421000-170421022 GTGATACAGCAGCAGGCACGCGG - Intergenic
1020308584 7:6853474-6853496 GTGTGCCAGGAGCAGCCAGGTGG + Intergenic
1021218189 7:17942425-17942447 GTGTTACAGAAGCAGGGAGCAGG - Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022469797 7:30675155-30675177 GTGCTTCAGAGTCAGGCAGGCGG - Intronic
1022615236 7:31923092-31923114 GTGTTTCAGCATCAGCCACTCGG - Intronic
1022808502 7:33846732-33846754 GTTTTACAGCAGCAGGCATCAGG - Intergenic
1023025038 7:36042408-36042430 GTGGTTCAGCTGCAGGAAGGGGG + Intergenic
1024563346 7:50662471-50662493 ATGCTTCAGCCCCAGGCAGGAGG + Intronic
1025050790 7:55732399-55732421 GTGTTCCAACAGCAGACGGGAGG + Intergenic
1027946722 7:84756694-84756716 GTGTTCCTGCAGGAGGCTGGAGG - Intergenic
1031452652 7:121940894-121940916 CTGGTATAGCAGCAGGCAGGGGG - Intronic
1031988237 7:128177813-128177835 GGGTGTCAGCAGCATCCAGGGGG + Intergenic
1034468386 7:151243075-151243097 GTGTTTCATCATCAGGGAGGAGG + Intronic
1035032505 7:155870591-155870613 GTGTTTCAGGAGCTCCCAGGAGG - Intergenic
1035321908 7:158035460-158035482 GTGTGGCAGTGGCAGGCAGGGGG + Intronic
1035881416 8:3247348-3247370 GCGGTTCAGGAGCAAGCAGGCGG - Intronic
1035918174 8:3648080-3648102 GTGTTCTAGCTGCAGGAAGGAGG + Intronic
1038212943 8:25536728-25536750 ATATTTATGCAGCAGGCAGGGGG + Intergenic
1038250513 8:25899816-25899838 ATGTTGCAGCAACAGGCACGAGG + Intronic
1042550167 8:69987420-69987442 GTGTTCCAACAGCAGACGGGAGG - Intergenic
1044829510 8:96233208-96233230 CAGTTTCAGCATCAGGCAAGTGG - Exonic
1044998298 8:97858056-97858078 GTGTTGCAGCAGCAGACAGGAGG - Intergenic
1046819049 8:118616656-118616678 GGGCTCCTGCAGCAGGCAGGTGG - Intronic
1047402530 8:124558646-124558668 CTGTCTGAGCAGCAGGCAGGGGG + Intronic
1048692549 8:136983849-136983871 GTGTCTCAGCTGGCGGCAGGTGG + Intergenic
1048718164 8:137291660-137291682 GTGTTTGAGAAGCAGTGAGGAGG - Intergenic
1049098116 8:140560692-140560714 CTGTGACAGCAGCAGGCTGGGGG + Intronic
1049884323 9:17433-17455 TTGTTACAGCACCAGCCAGGGGG + Intergenic
1049934897 9:492089-492111 GTGTTCCAGGAACAGCCAGGAGG + Intronic
1050920918 9:11199554-11199576 CTGCTTAAGCAGCAGGCTGGGGG + Intergenic
1051123601 9:13778767-13778789 GTCTTTCAGAAACAAGCAGGCGG - Intergenic
1052031334 9:23632328-23632350 GTATTCCAGCAGCAGACAGGAGG + Intergenic
1053308611 9:37001436-37001458 GTGTTGCTGCAGGAGGCAGTGGG - Intronic
1053330997 9:37206880-37206902 GTGTTTCAGGCAGAGGCAGGGGG + Intronic
1055277107 9:74630468-74630490 GAATGTCAGCAGCAGGCAGAAGG - Intronic
1055339823 9:75269337-75269359 GTTTTACAGCTGTAGGCAGGAGG + Intergenic
1055397311 9:75889786-75889808 CTGTGACTGCAGCAGGCAGGAGG - Intergenic
1055664517 9:78539977-78539999 GTGATTCAGAAGCAGGCACATGG + Intergenic
1056287939 9:85110246-85110268 GTGTTCCAGGAGCAGCCAGGAGG - Intergenic
1058107630 9:100990815-100990837 GTGTTTTAGCAGCTGGCAAGGGG - Intergenic
1061143358 9:128781687-128781709 GTTGTTCAGCAGGAAGCAGGTGG - Intergenic
1061766987 9:132887784-132887806 GGGTGTTAGCACCAGGCAGGTGG + Intronic
1062163320 9:135092153-135092175 GTGGTTCAGCACCAGGAATGTGG - Intronic
1062413627 9:136437184-136437206 GTGGTGCACCAGCAGGCAGGTGG - Intronic
1062506964 9:136882529-136882551 GGGTTGCAGGAGCAGGAAGGAGG - Intronic
1186474311 X:9845433-9845455 CTGTTCCAGCAGGAAGCAGGGGG - Intronic
1189047164 X:37605628-37605650 GTGTTTCAGGAACAGTAAGGAGG - Intronic
1189166140 X:38863025-38863047 ATGGCGCAGCAGCAGGCAGGAGG + Intergenic
1190331818 X:49240606-49240628 GTTTATCAGCAGCAGGCAAAAGG + Intronic
1194254972 X:91624228-91624250 GTGCTGCAGCAGTATGCAGGTGG + Intergenic
1195428165 X:104758982-104759004 ATGTCTCAGCAGGAGGCTGGGGG - Intronic
1195771771 X:108358920-108358942 GTGCTTCTGGAGCAGGCATGAGG + Intronic
1196440846 X:115718952-115718974 GTGTTCCAACAGCAGACGGGAGG - Exonic
1198393932 X:136204674-136204696 GTGTGTCAGCAGGAGGCAGAAGG + Intronic
1200401482 X:156022723-156022745 TTGTTACAGCACCAGCCAGGGGG - Intergenic