ID: 1015985545

View in Genome Browser
Species Human (GRCh38)
Location 6:138880826-138880848
Sequence AGGGGACTTCACGGGGGCTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015985545_1015985555 6 Left 1015985545 6:138880826-138880848 CCGTAGCCCCCGTGAAGTCCCCT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1015985555 6:138880855-138880877 TGAACAGCACAAACCAGCAAGGG 0: 1
1: 0
2: 1
3: 28
4: 256
1015985545_1015985557 8 Left 1015985545 6:138880826-138880848 CCGTAGCCCCCGTGAAGTCCCCT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1015985557 6:138880857-138880879 AACAGCACAAACCAGCAAGGGGG 0: 1
1: 0
2: 2
3: 22
4: 235
1015985545_1015985556 7 Left 1015985545 6:138880826-138880848 CCGTAGCCCCCGTGAAGTCCCCT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1015985556 6:138880856-138880878 GAACAGCACAAACCAGCAAGGGG 0: 1
1: 0
2: 0
3: 20
4: 182
1015985545_1015985554 5 Left 1015985545 6:138880826-138880848 CCGTAGCCCCCGTGAAGTCCCCT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1015985554 6:138880854-138880876 CTGAACAGCACAAACCAGCAAGG 0: 1
1: 0
2: 2
3: 20
4: 341
1015985545_1015985558 9 Left 1015985545 6:138880826-138880848 CCGTAGCCCCCGTGAAGTCCCCT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1015985558 6:138880858-138880880 ACAGCACAAACCAGCAAGGGGGG 0: 1
1: 0
2: 1
3: 18
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015985545 Original CRISPR AGGGGACTTCACGGGGGCTA CGG (reversed) Intronic
900497216 1:2981322-2981344 GGGGGACTTCTGGGGGGCAATGG - Intergenic
900598552 1:3493436-3493458 GGGGGACATCAAGGGGGCTGTGG - Intronic
901457460 1:9371382-9371404 AGGAGACTTCTCGGGGAGTAGGG + Intergenic
903000281 1:20260560-20260582 AGGGAACTCCACAGGGGCTCTGG + Intergenic
904147278 1:28403271-28403293 AGTGGACCCCACGGGGGCTCTGG + Intronic
905168810 1:36098428-36098450 AGGGGACTTCCTGGGGCCCATGG - Exonic
915789669 1:158654655-158654677 TGGTGACTTCTCGGGGGCTGCGG + Exonic
917471836 1:175332385-175332407 GGGGGACTTCACTGGGGAGAAGG - Intronic
918900951 1:190416676-190416698 AAGGCACTTCACGGTGACTAGGG - Intronic
921068930 1:211643010-211643032 AGGGGAGCACAGGGGGGCTATGG + Intergenic
922071449 1:222198436-222198458 AGGGGAGTTCATGGAGGCCAAGG - Intergenic
1067539132 10:47138916-47138938 AGGGCACTTCAGTGGGGCTTGGG - Intergenic
1067756995 10:49012675-49012697 AGAGGGCTCCACGGGGGCTGTGG + Intergenic
1076482812 10:130796005-130796027 AGGGGACATCACAGCGGCTTGGG + Intergenic
1076690216 10:132219868-132219890 AGGAGGCTGCACGGGGGCTGAGG + Intronic
1077300082 11:1842748-1842770 ATGGGACCTCCCGGGGGCAAGGG - Intergenic
1086500272 11:87445706-87445728 AAGGGACTTGAGGGGGGCCATGG + Intergenic
1089663535 11:120001655-120001677 ACGGGACTTCACAGGAGCTGAGG - Intergenic
1097182029 12:57177276-57177298 ATGGGACTTCAGGGGGGCCATGG - Intronic
1102375568 12:112418871-112418893 CGGTGACATCACGGGGGCGACGG + Intronic
1103932487 12:124457953-124457975 AGGTGGCTTCATGGGGGCTGTGG + Intronic
1104975170 12:132548955-132548977 AGGGGTCTGCACAGGGGTTAGGG + Intronic
1112950430 13:104988872-104988894 ATGGGACTTCAGGATGGCTAAGG + Intergenic
1115121793 14:29945758-29945780 AGGGGACTTAAGGGGAGGTAAGG + Intronic
1119477979 14:74942132-74942154 AGGGGAGATCACGGGGGACAAGG + Exonic
1120907128 14:89630459-89630481 AGGGGGCTTCACCGAGGCAAAGG - Intronic
1121251713 14:92504692-92504714 CGGAAACTTCATGGGGGCTACGG + Intergenic
1126437175 15:48647443-48647465 AGGGGACTTGACCTAGGCTAGGG + Intergenic
1127899996 15:63334067-63334089 GGGGGACATCACAGGGGCTCAGG - Intronic
1137508770 16:49079981-49080003 AGGGGAGTTCAGGGTGGCTGAGG - Intergenic
1137591447 16:49696566-49696588 TGGGCACTTCAAAGGGGCTAGGG - Intronic
1143634392 17:8156078-8156100 CAGGGACTCCACGGGGGCGAGGG + Intronic
1146308187 17:31746652-31746674 AGGGGACATCACTGGGCCTGTGG + Intergenic
1146495402 17:33317810-33317832 AGAGGACTTCACGGAGGAGATGG + Intronic
1152362993 17:79840921-79840943 TGGGGACCGCACGGGGGCTCGGG + Intergenic
1153040962 18:812458-812480 AGGGGACCTGACGGGGGCGTAGG - Exonic
1155191831 18:23437375-23437397 CTGGAACTTCACGGGGGCTCTGG + Intronic
1156603228 18:38635544-38635566 AGGAGAATTCACTGGGACTAGGG + Intergenic
1160120039 18:76122048-76122070 AGGGGACTTCAAAGAGTCTATGG + Intergenic
1160921172 19:1521548-1521570 AGGGGAGTTTTGGGGGGCTAAGG - Intergenic
1165494224 19:36142322-36142344 AGGGGGCTTACCGGGGGCTCCGG - Exonic
928233072 2:29516533-29516555 AGGGGACTTCACAGTGGCCCTGG - Intronic
929549855 2:42883162-42883184 AGGCAACTTCACTGGGGGTAGGG - Intergenic
929780784 2:44955615-44955637 AGGGGACTTCCCTGGGTCTCTGG - Intergenic
931139212 2:59438516-59438538 AGGGGAGGTCAGGTGGGCTAAGG - Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
936286931 2:111188108-111188130 AGGGGGCTTCAGGGCGGCTCTGG + Intergenic
937125430 2:119472365-119472387 AGGGGCCCTAACGGGGGCAAAGG + Intronic
937638223 2:124180971-124180993 AGGGGACTTCATGGTGGCCTTGG - Intronic
938561137 2:132472965-132472987 AGGGGGGTTCACGGTGGATAAGG - Intronic
1169147400 20:3261863-3261885 AGGGGAATTTGCAGGGGCTAAGG + Intronic
1169928129 20:10804027-10804049 AGTAGAATTCAGGGGGGCTAAGG + Intergenic
1170552841 20:17491830-17491852 AGGGGACTGCAGGGGGACAATGG - Intergenic
1170770240 20:19326342-19326364 TGGGGACTTGATGGGGACTATGG + Intronic
1173352837 20:42260878-42260900 AGGGGACCTCACTGGGGAGATGG + Intronic
1178025352 21:28460239-28460261 ATGGGACCTCACTGGGTCTAGGG - Intergenic
1179001435 21:37463535-37463557 AGGGGACTGCACGGGAGGTAAGG - Intronic
1180707074 22:17816653-17816675 AGGGGGCTTCACAGGGCCTGGGG - Intronic
1183318872 22:37152823-37152845 ATGGAACTTCACAGGGTCTATGG - Intronic
1183494693 22:38136144-38136166 ATGGGACTTATCGGGGGCTGTGG + Intronic
954320278 3:49827843-49827865 AGGGGACTTCACCCAGGCTGGGG + Intergenic
967490798 3:190089013-190089035 TGGGGACACCACGGGGGCCATGG - Intronic
980905942 4:138949006-138949028 AGGAGACATCACTGAGGCTAGGG + Intergenic
988848728 5:35157365-35157387 AGGATACTTCAAGGGGGCTGAGG + Intronic
994736281 5:103560577-103560599 AGGGGACTTCACGATGGGTGGGG + Intronic
998423933 5:142011806-142011828 AAGGGACTTCACGGGGGCTCTGG - Intronic
1004281178 6:14281009-14281031 AGGGGACTTCACTGGGCAGAGGG + Intergenic
1005851273 6:29824564-29824586 TGAGGGCTTCACTGGGGCTAGGG - Intergenic
1006225543 6:32533904-32533926 AGGAGACTTCTCAGGAGCTATGG - Intergenic
1015985545 6:138880826-138880848 AGGGGACTTCACGGGGGCTACGG - Intronic
1017258311 6:152359785-152359807 AGGGGGCTTCATGGGGGCTGGGG - Intronic
1019031689 6:169018843-169018865 AGGGGGGTACACGGGGGCCAGGG + Intergenic
1019607678 7:1918288-1918310 AGGGGACTGCGCTGGGGCTGAGG - Intronic
1023984890 7:45088709-45088731 AGGGGACTCGAGGGGGGCCAGGG + Intronic
1029438530 7:100575251-100575273 AGGGCACTGCCCGGGGGCTGCGG - Exonic
1031692985 7:124813740-124813762 AGAGGACTTCAAGGGAGCAATGG + Intergenic
1032863248 7:135901880-135901902 ATGGGACTTCACAGTGGCTCTGG - Intergenic
1035634038 8:1130058-1130080 CGGGCACTTCACGTGGGTTAAGG + Intergenic
1036777108 8:11621024-11621046 TGGGGATTTCTCGGGGGCTTTGG - Intergenic
1041464793 8:58146925-58146947 GGGGGACTTCATGGAGGCGATGG - Exonic
1047471297 8:125175664-125175686 AGGGGAGATCACAGGAGCTAAGG - Intronic
1049248241 8:141574313-141574335 AGGGGACTGAGCGGGGGCTCAGG - Intergenic
1049491275 8:142904436-142904458 GGGGGACATCACGTGGGCTGTGG - Intronic
1051595769 9:18823328-18823350 AGGGGACTTCATGGGAGAAATGG - Intronic
1057399730 9:94712433-94712455 AGGTGACCTCCCGGGGCCTAGGG + Intergenic
1057553713 9:96071107-96071129 TGGGGACTTCAGGGTTGCTACGG + Intergenic
1058539068 9:105993198-105993220 GCTGGACTTCACGGGGGCCAGGG - Intergenic
1189526606 X:41829255-41829277 AGGGGACATGATGGGAGCTACGG - Intronic
1195388004 X:104331657-104331679 TGGGGACTTCAAGGGGTCTGTGG + Intergenic