ID: 1015989308

View in Genome Browser
Species Human (GRCh38)
Location 6:138919751-138919773
Sequence CTGTGAATAAAAATAAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 833
Summary {0: 1, 1: 0, 2: 15, 3: 122, 4: 695}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015989308 Original CRISPR CTGTGAATAAAAATAAAGCT GGG (reversed) Intronic
900984985 1:6068026-6068048 GTCTCAAAAAAAATAAAGCTAGG + Intronic
901585014 1:10282903-10282925 CTGTTAATAAAGATGAAGTTTGG + Intronic
902214760 1:14927444-14927466 CTATGCAGAAAAATAAAGCCGGG + Intronic
902261165 1:15225987-15226009 ATGAGAAGAAAAATAAAGCTGGG + Intergenic
903086853 1:20868819-20868841 CTGTGTAAAAATAAAAAGCTAGG - Intronic
903649676 1:24914954-24914976 CTATGAAGAAAAACAAAGCTGGG - Intronic
904483862 1:30811223-30811245 CTGTCTATGCAAATAAAGCTTGG - Intergenic
904571134 1:31466077-31466099 CAGTTAATAAAAACAAAGATTGG + Intergenic
904914923 1:33962834-33962856 CTATGAATAAAAAGGAAGCAGGG - Intronic
904954840 1:34274364-34274386 CAGTGAAAAAAACTAAGGCTTGG + Intergenic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905294856 1:36947677-36947699 CTTTGAAGAAAAATAAAGGAGGG - Intronic
905619919 1:39435903-39435925 CTTGGAATAAAAATGAAGATAGG - Intronic
905831953 1:41076578-41076600 CTGTGATTAAAATTAATGCAGGG + Intronic
906483629 1:46218100-46218122 CTTTGATTAGAAATAAAACTGGG + Intronic
906991117 1:50740197-50740219 TTTTGACTAAAAATAAAGCAGGG + Intronic
907184244 1:52597543-52597565 CTAAAAATAAAAATAAAGGTAGG - Intergenic
907381980 1:54098511-54098533 TTCTGAAGAAAAATAAAGCTAGG - Exonic
907490631 1:54806773-54806795 CTGTGGAGAAAAATGAAGCTGGG + Intronic
908556723 1:65263957-65263979 CTGTGAAGAAAAATGAAACATGG - Intronic
908610606 1:65855962-65855984 CTGTAAACAAAAAGAAAACTGGG - Intronic
908684573 1:66701002-66701024 CTGTGAAAAAAATAAACGCTTGG + Intronic
909049999 1:70755024-70755046 CTGTGAAATAAAATAAATCCTGG + Intergenic
909086367 1:71173783-71173805 CTGTGAAGAAAAATAAAGCAGGG - Intergenic
909174255 1:72335606-72335628 CTATGAAGAAAAATACAGCAAGG + Intergenic
909182575 1:72443505-72443527 CTGAAAATAAAAAGAAATCTAGG - Intergenic
909193031 1:72578683-72578705 ATGGTAATAAAAATGAAGCTGGG - Intergenic
909365883 1:74821314-74821336 ATGTAAATAATAATAAAGATGGG + Intergenic
909380542 1:74993061-74993083 CTATGAAGAAAAATAAAGTAGGG + Intergenic
909486510 1:76179986-76180008 CAGTGAAGAAAAGTAAAGCATGG - Intronic
909496623 1:76286139-76286161 CTGTGGCTAAAAATAAAGAGTGG - Intronic
909676884 1:78248690-78248712 CTGTGAAGCAAAATAAAGTGAGG + Intergenic
909854804 1:80515228-80515250 TTGTGAGTAAAAATAAATTTTGG + Intergenic
910219064 1:84871943-84871965 CTGTGGAGAAAAATAAAGCAGGG - Intronic
910536923 1:88309201-88309223 CTATGAATAAAAATGAAGCAGGG + Intergenic
910781523 1:90940816-90940838 CTGATAACAAAAATAAAACTTGG + Exonic
910818288 1:91316325-91316347 CTTTTAATAGAAATAAAGGTAGG + Intronic
910938350 1:92505600-92505622 CTATGGAGAAAAGTAAAGCTAGG + Intergenic
911843095 1:102710015-102710037 CTGTGAAGAAAAATCAAACCAGG + Intergenic
911863881 1:102991278-102991300 CTGTGTATGAAAACAAAGCTAGG + Intronic
912043718 1:105426154-105426176 TTGTGAAAGAAAATAAAGTTAGG - Intergenic
912688929 1:111789093-111789115 CTGTGGATGAAAATAAAGCATGG + Intronic
913312214 1:117511776-117511798 CTATGAAGAAAAGTAAAGCAGGG - Intronic
913500415 1:119467773-119467795 CTATGAAACAAAACAAAGCTTGG - Intergenic
913513977 1:119587122-119587144 CAGTGAATAAAAAGAATGCATGG + Intergenic
913517653 1:119618097-119618119 CAGTGAATAAAAAGAATGCATGG + Intergenic
914952077 1:152124993-152125015 CTATGAAAAGAAATACAGCTGGG - Intergenic
915691034 1:157690952-157690974 CTATGTAGAAAAATAAAGCAAGG - Intronic
916403740 1:164476378-164476400 CTGTTACTAAAAATAAAGCATGG + Intergenic
916549061 1:165832062-165832084 CTGTGTAGAAAAATAAGGCCGGG - Intronic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
916957016 1:169849083-169849105 CTATGGAGAAAAATAAAGCAGGG + Intronic
917300780 1:173571561-173571583 CTATGAAAATAAATAAAGCATGG - Intronic
917488610 1:175478194-175478216 CTGTGTATAGAAATTAAACTGGG - Intronic
917598284 1:176551775-176551797 CTGTGGATAGAAATAAAGGAAGG + Intronic
918296406 1:183161250-183161272 CTATGAAGAAAAATAAAGCTGGG + Intergenic
918408856 1:184237641-184237663 CTGGGAAGAAAAATAAAGCAGGG + Intergenic
918750251 1:188261746-188261768 CTTTAAATGAAAAGAAAGCTTGG + Intergenic
918805609 1:189038036-189038058 GTGGCAATTAAAATAAAGCTGGG - Intergenic
918940101 1:190982702-190982724 CTGTGACAAAGAATAAAGCTGGG - Intergenic
919524821 1:198634288-198634310 CTGTCCATACAAATCAAGCTGGG - Intergenic
919688046 1:200502765-200502787 CTGTAGAGAAAAATAAAGCAGGG - Intergenic
921056715 1:211548163-211548185 CTAAGGAGAAAAATAAAGCTGGG - Intergenic
921204052 1:212833020-212833042 CTGTGGTAAAAAAGAAAGCTGGG + Intronic
921352636 1:214252165-214252187 CTGGGCAAAAAAATAAATCTAGG - Intergenic
921895507 1:220395641-220395663 CTGTAGATAAAAATAAAGCAGGG - Intergenic
922105050 1:222506403-222506425 TTGTAAAAAAAAAAAAAGCTTGG - Intergenic
922526068 1:226305167-226305189 CTTTAAAAAAAAATAAAGATAGG + Intronic
922883583 1:229001040-229001062 CTGAAAATAAAAATTTAGCTGGG + Intergenic
923448243 1:234092559-234092581 CTGCGAATAAAAATGAATGTAGG + Intronic
923692912 1:236213554-236213576 CTGTTAAAAAAAAAAAAGGTGGG + Intronic
924035514 1:239932128-239932150 CTGTGAAGAAAAATAAAGTAGGG - Intergenic
924284984 1:242476762-242476784 CAATGAAAAAAAATAAACCTGGG - Intronic
924622547 1:245674669-245674691 CATTGAATAAAAATAAATGTAGG + Intronic
1062780640 10:202927-202949 CTGTGGATAAAAATATATCAAGG + Intronic
1062858714 10:793388-793410 CAGTGAATAAAAGTCAGGCTTGG + Intergenic
1064575764 10:16744949-16744971 CTGTGGATAAAAGAAAGGCTGGG - Intronic
1064583742 10:16818840-16818862 TTATGATTAAAAATAATGCTGGG + Intergenic
1064921611 10:20525460-20525482 CTATGGATAAAAGTAAAGCCAGG - Intergenic
1065274453 10:24071970-24071992 CAGTCATAAAAAATAAAGCTGGG - Intronic
1065417345 10:25502703-25502725 CTGTGAATAAATTTCAAGCAAGG + Intronic
1065582334 10:27184205-27184227 CTAGGAAGAAAAATAAAGCAGGG + Intronic
1065627938 10:27650381-27650403 CTATAAAAAAAAATAGAGCTGGG + Intergenic
1065640685 10:27779030-27779052 CTATGCATAAACATAAATCTAGG - Intergenic
1066031041 10:31425245-31425267 TTGAGAATAAAAAGAAATCTAGG + Intronic
1066526473 10:36284436-36284458 CTGTAAATAAAAATAAACGGTGG + Intergenic
1067321590 10:45225851-45225873 TTATGATTAAAAATAATGCTGGG + Intergenic
1068092982 10:52455476-52455498 CTTTGGAGAAAAATAAAGCAGGG - Intergenic
1068146253 10:53074760-53074782 ATGTGAACAAAAATAAAACCAGG + Intergenic
1068239201 10:54282794-54282816 TTGTGAATAAAAGTATTGCTAGG + Intronic
1068400659 10:56523578-56523600 CTATTAATAAAAAAAAACCTTGG + Intergenic
1068599370 10:58939726-58939748 CAGTGAAAAAAAATAATGTTAGG + Intergenic
1068618119 10:59143917-59143939 CTGTGTGTAAAAATAAAGTAAGG + Intergenic
1068696348 10:59971952-59971974 CCATGAAGAAAAATAAAGCAGGG + Intergenic
1068707761 10:60095680-60095702 TTTTTAATAAAAATAAAACTAGG - Intronic
1068826754 10:61448866-61448888 CTGAGAATAAGTAGAAAGCTAGG - Intronic
1069032989 10:63617740-63617762 ATGTGATAAAAAATAAAACTGGG - Intronic
1069909341 10:71750129-71750151 ATGTGTATAAAAACAAAGCCAGG + Exonic
1070325386 10:75385363-75385385 TTGTGAATAAAATAAAAGTTGGG - Intergenic
1071969143 10:90885037-90885059 CAGGGAAGAAAAATAAAGCTGGG - Intronic
1072081406 10:92036019-92036041 CTGCTAACAAAAAGAAAGCTGGG + Intergenic
1072493936 10:95935852-95935874 TTATGAAGAAAAATAAAGCAGGG - Intronic
1072509036 10:96100006-96100028 CTGTGAAGACAAATAAAACAGGG + Intergenic
1072847336 10:98846359-98846381 CTGTGAAGAAAATTAAACCTGGG + Intronic
1072892085 10:99332616-99332638 CTTTGAATACAAACAAATCTGGG + Intronic
1073086174 10:100890671-100890693 CTGTGCATAAAATCAAAGCAAGG + Intergenic
1073356099 10:102855700-102855722 CTGTGAAGCAAAATTAATCTGGG + Intronic
1073586261 10:104712940-104712962 CTATGGAGAAAAATAAAGCAGGG + Intronic
1073626941 10:105108084-105108106 CTATGAATAAAAATAAATCAGGG + Intronic
1073906977 10:108293193-108293215 CAATGAATAAAAATAAAGTAGGG + Intergenic
1074171741 10:110946509-110946531 TTGTGAAGAAAAATAAAGCAGGG + Intronic
1074306027 10:112279338-112279360 CTGTGAATGAAAATATTGATTGG + Intergenic
1075088968 10:119432285-119432307 CTGTTATAAAAAATAAAGCTGGG + Intronic
1075940082 10:126383827-126383849 CTGTGAGTAAAAACAAAGGTTGG - Intronic
1075996554 10:126881542-126881564 CTGAAATTAAAAATAAAGATGGG + Intergenic
1076303362 10:129445488-129445510 TTCTGAATAAACATAAACCTGGG - Intergenic
1077418093 11:2435216-2435238 CTATGGAGAAAAATAAAGCAGGG + Intergenic
1078487983 11:11741659-11741681 CTGGGAAAAAAAATAAAGGCAGG + Intergenic
1078538626 11:12195657-12195679 ATATGAAGAAAAATAAAACTAGG + Intronic
1078606115 11:12777086-12777108 CTTTAAAAAAAAATAAGGCTGGG - Intronic
1079120835 11:17683806-17683828 CTCTGTATAAAAACAAAGCGGGG - Intergenic
1079145122 11:17844336-17844358 CTTTTTATAAAAATAAAGCTTGG + Intronic
1079887785 11:26010038-26010060 ATATGATTAAAAATAAGGCTAGG - Intergenic
1080324827 11:31058473-31058495 TCGTGAAGAAAAATAAAGCAGGG + Intronic
1080360971 11:31513272-31513294 ATGAGAATCAAAATAAAGCTAGG - Intronic
1080554213 11:33401565-33401587 CTGTCTAAAAAAAAAAAGCTAGG - Intergenic
1081541101 11:44035163-44035185 CTGTGAAGAAAACTCAAGTTGGG - Intergenic
1081704002 11:45170038-45170060 CTCTGGAGAAAAATAAAGCAAGG + Intronic
1081821412 11:45999298-45999320 TTGAGATTAAAAATAAAACTTGG + Intronic
1082186793 11:49191961-49191983 CTGTGTATAAAAAAACAGGTTGG - Intronic
1082731842 11:56807570-56807592 CTTTCAATAAAAATAAAACTGGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084588673 11:70078161-70078183 CCCTGGATAAAAATAAAACTTGG + Intergenic
1084693550 11:70740640-70740662 ATGTGATTAAAAATAAACTTGGG - Intronic
1084932211 11:72565449-72565471 CTGTGAATAGAAATAAGACAGGG - Intergenic
1085207246 11:74743236-74743258 CTATGAATACAAATAAGACTTGG - Intergenic
1085751914 11:79169159-79169181 CTGTTAATCTAGATAAAGCTTGG - Intronic
1085838379 11:79981101-79981123 CTGTGAATAACAATGAAGCCTGG + Intergenic
1085895727 11:80637283-80637305 CTGTGAAGAAAAAAGAAGCTTGG + Intergenic
1086543106 11:87936330-87936352 AAATAAATAAAAATAAAGCTTGG - Intergenic
1086771997 11:90777888-90777910 CAGAGAAGAAAAATAAAGCAGGG + Intergenic
1086972740 11:93101247-93101269 TTATGAATAAAAATAAATCAAGG + Intergenic
1087118868 11:94551979-94552001 ATGTAAATAAAATTAAAGCAGGG + Intronic
1087543550 11:99552456-99552478 CTAAGAATAAAAATAAGGCAGGG + Intronic
1089534584 11:119152916-119152938 CTATGAAGAAAAATAAAATTAGG - Intronic
1090479897 11:127058869-127058891 CTATGAGTAAAAATAAATCTGGG - Intergenic
1091064003 11:132491589-132491611 CTATGAATAAAAATAAAACAAGG - Intronic
1091516150 12:1184276-1184298 CTGTCTTTAAAAAAAAAGCTAGG - Intronic
1092091454 12:5807027-5807049 CTTTTGCTAAAAATAAAGCTAGG + Intronic
1092464611 12:8719335-8719357 CTGGGATTATAAATTAAGCTGGG + Intronic
1092750393 12:11713691-11713713 CTATGAAGAAAAACAAAGCAAGG - Intronic
1092938269 12:13384343-13384365 AAGTGAATACAAATAAAACTAGG - Intronic
1092941871 12:13417399-13417421 CTGTCACCAAAAATAAAGATGGG - Intergenic
1093110258 12:15143758-15143780 CTATGAAGAAAAGTAAAGCAGGG + Intronic
1093202523 12:16206760-16206782 CTGTGGATAAAAATGAAGTCAGG + Intronic
1094235915 12:28166016-28166038 CTGTAAATAAATAAATAGCTAGG + Intronic
1094332183 12:29305979-29306001 CTGTAAAAAAAAAAAAACCTAGG - Intronic
1094338170 12:29383785-29383807 CCCTCAATGAAAATAAAGCTTGG + Intergenic
1094438813 12:30452304-30452326 CTCTGGAGAAAAATAAAGCAAGG - Intergenic
1094564563 12:31588344-31588366 CTATGAGGAAAAATAAAGCAGGG - Intronic
1095613307 12:44158244-44158266 TTGTCTATAAAAGTAAAGCTTGG + Intronic
1095769970 12:45942801-45942823 CTTTAAAGAAGAATAAAGCTGGG - Intronic
1096282081 12:50264850-50264872 CTGTGATTAAAAATAATTCATGG + Intronic
1096341641 12:50805853-50805875 TTGAGAAAAAAAATAAAGCCAGG + Intronic
1097630791 12:62059489-62059511 CTGTGAAGAAAAGTAAAGTGTGG + Intronic
1097808992 12:63998057-63998079 CTATAAAGAAGAATAAAGCTGGG - Intronic
1097888938 12:64758621-64758643 ATGTCAATAAAAATAAGCCTGGG - Intronic
1098299625 12:69040673-69040695 CTGAGGAGAAAAATAAAGCAGGG - Intergenic
1098299740 12:69042298-69042320 CTGAGGAGAAAAATAAAGCAGGG + Intergenic
1098350571 12:69555006-69555028 TTATTAAAAAAAATAAAGCTGGG - Intronic
1098570215 12:71980025-71980047 CTGTGAAGACAAATAGAGCATGG + Intronic
1098616469 12:72530813-72530835 CTTTGAAAATAAATAAAGCAGGG - Intronic
1098908893 12:76189199-76189221 CTATGGATAAAAATAAAGCCAGG - Intergenic
1098935100 12:76469706-76469728 CTGTGACGAAAAATAAAGCAGGG - Intronic
1099015737 12:77341839-77341861 CTGTTAATAAAAAAAGAGGTGGG + Intergenic
1099200140 12:79666903-79666925 GTGTGAAAGAAAATAAATCTTGG + Intronic
1099214174 12:79834122-79834144 TTGTGAAGAAAAATAAAGCAAGG + Intronic
1099222376 12:79930475-79930497 CTAGGGATAAAAATAAGGCTAGG + Intronic
1099505903 12:83475865-83475887 CATTGAATAAACCTAAAGCTAGG + Intergenic
1100302680 12:93322630-93322652 CTGTTAAAAAAAAAAAGGCTGGG + Intergenic
1100449182 12:94688932-94688954 CTAAGAAGAAAAATAAAGCAGGG - Intergenic
1100462037 12:94809381-94809403 CTATGAATAAAAGTCAAGCAGGG + Intergenic
1100718925 12:97335773-97335795 CTGTGAATTAAAATAAAGCACGG - Intergenic
1101092603 12:101303347-101303369 CTGTGAAGAAAAACAAAGCAGGG + Intronic
1101563231 12:105880129-105880151 CTAGGAAGAAAAATAAAGCAAGG - Intergenic
1101649014 12:106657820-106657842 CTATAAAGAAAAATAAAGCATGG - Intronic
1102284980 12:111648625-111648647 CTCTGTCTAAAAATAAAGATGGG + Intronic
1102954611 12:117051442-117051464 CTGTGAAAACACATAAAGATGGG - Intronic
1104011341 12:124932523-124932545 CTTTTGTTAAAAATAAAGCTGGG - Intergenic
1104117402 12:125762889-125762911 GTATGAATACAAATAAAACTGGG + Intergenic
1104203382 12:126613990-126614012 CTATGAATAAAAATGTAGCTTGG - Intergenic
1104767038 12:131336825-131336847 CCTTCAATAAAAAGAAAGCTTGG - Intergenic
1105433604 13:20359061-20359083 CTGTGAAAAAAAAAAAAGAAAGG - Intergenic
1106532218 13:30604054-30604076 CTGTGATGAAAAATAAAGCAGGG + Intronic
1107368062 13:39707425-39707447 CTGCAGTTAAAAATAAAGCTTGG - Intronic
1107584383 13:41829037-41829059 CTCTCAACAAAACTAAAGCTGGG - Intronic
1107913892 13:45129808-45129830 CTCTGAAGAAAAATAAAACAAGG + Intronic
1108841705 13:54625918-54625940 CTATGAAGGAAAATAAAGCAGGG + Intergenic
1109468395 13:62770005-62770027 ATGTGAATAAAAATATTTCTTGG - Intergenic
1109751704 13:66701571-66701593 CTGAGAATAAATAAAAAGCTAGG - Intronic
1109759042 13:66802739-66802761 CTGAGAATAACAAAAAATCTTGG + Intronic
1109767463 13:66922358-66922380 GTTTGCATAAAAATAAAGCAGGG - Intronic
1109976499 13:69841463-69841485 CAGTGACTAAAAAGAAAACTAGG + Intronic
1110015285 13:70392488-70392510 CTCTGAAGAAAAAAAAAGCAGGG - Intergenic
1110100447 13:71594973-71594995 CTGTGGAGAAAAATAAAACAGGG + Intronic
1110103997 13:71647131-71647153 CTGTTAATAAAAATGATACTTGG + Intronic
1110230851 13:73165788-73165810 CTGTATCTAAAAATAAGGCTAGG - Intergenic
1110270283 13:73581627-73581649 CTCTTAATAAAAAGAAAGTTGGG + Intergenic
1110361832 13:74634611-74634633 ATGTAAATAAAAATAAAAATTGG - Intergenic
1110463543 13:75774976-75774998 CTATGAAGAAAAATAAAGCAGGG + Intronic
1111253015 13:85629436-85629458 AACTGAATAAAAACAAAGCTTGG - Intergenic
1111372471 13:87335486-87335508 CCTTCAATAAAAAGAAAGCTTGG - Intergenic
1111753773 13:92366970-92366992 CTTTGAAGAAAAATAAACCTAGG - Intronic
1111941455 13:94612765-94612787 CTGTTTATAAAAATAATGCAAGG - Intronic
1112222078 13:97501234-97501256 CTATGGAGAAAAATAAAGCAAGG + Intergenic
1112296081 13:98188398-98188420 CAAAGAAAAAAAATAAAGCTGGG + Intronic
1112558240 13:100488889-100488911 ATGTGAAAAAAAATAAAAGTGGG - Intronic
1112641804 13:101283756-101283778 ATGTTAAAAAAAAAAAAGCTAGG + Intronic
1112691023 13:101894018-101894040 GTGTGAAAAAAAAAAAAGCCAGG - Intronic
1113174061 13:107541162-107541184 CTGTCAAAAAATAAAAAGCTTGG + Intronic
1113314008 13:109159650-109159672 CTGTGTAGAAAACTAAAGCAAGG + Intronic
1114196334 14:20480112-20480134 CTTTGAAAAAAAAAAAAGATAGG + Intergenic
1114405655 14:22453726-22453748 CTGAGAAGAAAAATAAAGCCGGG + Intergenic
1114575562 14:23709633-23709655 CTAGGAAGAAAAATAAAGCCAGG - Intergenic
1114744547 14:25133733-25133755 CAATGAATAAGATTAAAGCTAGG + Intergenic
1114813017 14:25923328-25923350 CTTTGAATAATAAAAATGCTGGG - Intergenic
1114929511 14:27450091-27450113 CTATGAATGAAAATAATGATGGG - Intergenic
1115152394 14:30301080-30301102 CTGTGAAGAAAAAACAACCTAGG - Intergenic
1115298305 14:31855944-31855966 CTGTGAAGATAAATAACACTTGG + Intronic
1115561823 14:34589522-34589544 CTGTGATAAATAATAAAGTTGGG + Intronic
1116686507 14:48046613-48046635 CAGTGAGGAAAGATAAAGCTTGG + Intergenic
1117339892 14:54783982-54784004 CTATGAAGAAAAATAAAGCAGGG + Intronic
1117708763 14:58501248-58501270 ATGTGAATAAATGTAAAGATTGG + Intronic
1118134320 14:63004763-63004785 CTATGAAAAAAAAAATAGCTGGG - Intronic
1118918110 14:70125100-70125122 TTTTGAGTTAAAATAAAGCTGGG + Intronic
1119285605 14:73451788-73451810 CTCTGAATAAAGGCAAAGCTGGG - Intronic
1119412030 14:74438450-74438472 ATGGGAATGAAACTAAAGCTTGG + Intergenic
1119437900 14:74610236-74610258 CTATGAAGAAACATAAAGCAGGG + Intronic
1119791002 14:77349709-77349731 CAGTGAAGAAAAATGAAGCTGGG - Intronic
1119975415 14:79019457-79019479 CTATGAAGACAAATAAAGCAGGG + Intronic
1120291839 14:82584025-82584047 CTAAGAATAAAAGAAAAGCTAGG - Intergenic
1120396616 14:83974856-83974878 CTGTGGAAAAAAATAAACCGTGG + Intergenic
1120702544 14:87713830-87713852 ATGTGAAGAAAAATAAAGGAAGG + Intergenic
1121268736 14:92623437-92623459 CTATTAATAAAAATGTAGCTTGG - Intronic
1121871220 14:97409419-97409441 CTTTGAAAAAAAAAAAAGATTGG - Intergenic
1121941512 14:98075344-98075366 CTGTGAAGGAAAATAAAGCAAGG + Intergenic
1122501691 14:102204414-102204436 CTGTGGAGAAAAATAAACCAGGG - Intronic
1124639713 15:31390045-31390067 CTGTTAATAAAAAGGAAGCAAGG - Intronic
1125639161 15:41215179-41215201 CTGGGAATAAAAATAAAGCATGG - Intronic
1125712022 15:41794859-41794881 CTATGAAGAAAAGTAAGGCTGGG + Intronic
1126048296 15:44664404-44664426 CTATGATTAAAAACAAAACTAGG - Intergenic
1126256729 15:46636084-46636106 CTGTGAATAAAAACACAGGGAGG - Intergenic
1126475898 15:49064804-49064826 CTATGAATAAAAATAAAACATGG + Intergenic
1126727463 15:51646844-51646866 CAATGAAGAAAAATAAAGCCAGG + Intergenic
1126747114 15:51837359-51837381 CCATGAATGAAAATAAATCTTGG - Intronic
1127268323 15:57378677-57378699 CTGTTAATAAAAATACAGGCGGG - Intronic
1127470519 15:59286027-59286049 CTGTGCATATAAATAAAGACAGG + Intronic
1128193217 15:65724673-65724695 ATGAGAATAAAAATAAAGATAGG + Intronic
1128289221 15:66464075-66464097 ATGTGAAAGAAAATAAATCTTGG - Intronic
1128398324 15:67251832-67251854 CTTTGACTATAATTAAAGCTGGG - Intronic
1128759964 15:70209837-70209859 CTGTGGAGAAAAATAAAGCAGGG - Intergenic
1128779804 15:70351903-70351925 CTGGGAAGAGAAATAAAGCAAGG - Intergenic
1128888071 15:71306437-71306459 CTTTGAAGAAAGATAAATCTGGG - Intronic
1128947098 15:71832577-71832599 CTGTATATAACAATCAAGCTTGG - Intronic
1128992235 15:72270767-72270789 AAGTGGAAAAAAATAAAGCTGGG - Intronic
1129302695 15:74635021-74635043 ATGTGGATAAAAACAAAGCAGGG - Intronic
1129508420 15:76102337-76102359 TTCTGAAGAAAAATAAAGCTGGG + Intronic
1129604077 15:77016317-77016339 CTGGGAAGAAAAACAAATCTGGG - Intronic
1129705845 15:77793599-77793621 CTGTCATTATAAATAATGCTTGG - Intronic
1129852471 15:78801548-78801570 CTGTGGGGAAAAATAAAGCAAGG - Intronic
1130278242 15:82495020-82495042 CTGTAAATAAAAATGTAGATCGG + Intergenic
1130470571 15:84222205-84222227 CTGTAAATAAAAATGTAGATCGG + Intergenic
1130478059 15:84336772-84336794 CTGTAAATAAAAATGTAGATCGG + Intergenic
1130493706 15:84451358-84451380 CTGTAAATAAAAATGTAGATCGG - Intergenic
1130577416 15:85105021-85105043 CTGTGGAGAAGAATAAAGCCAGG + Intronic
1130592858 15:85226831-85226853 CTGTAAATAAAAATGTAGATTGG + Intergenic
1130814493 15:87416903-87416925 CTGTCAAAAACAATAAAGATTGG + Intergenic
1131362630 15:91806746-91806768 CTATGAAAGAGAATAAAGCTGGG + Intergenic
1131579114 15:93624015-93624037 CTATGAATAAAAATAAAGCAGGG - Intergenic
1132293167 15:100717351-100717373 GTTTAAATAAAAATAAAGGTGGG + Intergenic
1132439677 15:101847740-101847762 CTGTGGATAACAATTAAGCAAGG - Intergenic
1133530799 16:6653243-6653265 CTATGAAGAAAAATAAACCAAGG - Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134926988 16:18172839-18172861 TTGTAAATAAAATTAAAGTTGGG + Intergenic
1135197402 16:20405470-20405492 CTATGAAGGAAAATAAAGCCTGG - Intergenic
1135242932 16:20825668-20825690 GTGTGAGTGAAATTAAAGCTGGG - Intronic
1135412010 16:22242471-22242493 CTTTAAAAAAAAAAAAAGCTGGG - Intronic
1135588435 16:23688905-23688927 CTCTGGAAAAAAAAAAAGCTGGG - Intronic
1135913927 16:26586551-26586573 CTATGAAGAAAAATAAAGCAGGG + Intergenic
1135919237 16:26633511-26633533 CTGTGACTAAAATTAATGTTTGG - Intergenic
1137671641 16:50282708-50282730 CTGGAAAAAAAAAAAAAGCTGGG - Intronic
1138697392 16:58827797-58827819 CTGTGCATAAAAGTAAAGGTTGG + Intergenic
1138721377 16:59084928-59084950 CTGAGAATAGAAACAAAGCAAGG - Intergenic
1138937593 16:61748555-61748577 TTACGAATAAAAATAAAACTAGG + Intronic
1138961126 16:62031300-62031322 CTGTGACTAAAAATAGACTTAGG + Intronic
1139025087 16:62806121-62806143 CTGTGAAAGAAACTAAAGCTGGG + Intergenic
1139608049 16:68034066-68034088 TTGAAAATAAAAATAAAACTAGG - Intronic
1139825500 16:69754097-69754119 ATGTGAAAGAAAATTAAGCTGGG - Intronic
1140565889 16:76042308-76042330 ATGTGTATAAAACTAAAGCCTGG - Intergenic
1140574172 16:76145485-76145507 CTTTGAATTTAGATAAAGCTAGG + Intergenic
1140663280 16:77207966-77207988 CTGTGAAGAGAAATAAAGTGAGG - Intronic
1140920619 16:79534249-79534271 CTGTTACTTAAAATAAAGTTAGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141389607 16:83653716-83653738 ATTTGAAGAAAAATAAAGCAGGG - Intronic
1141984614 16:87571745-87571767 CTCAGAAGAAAAATGAAGCTGGG - Intergenic
1143239341 17:5430674-5430696 CTGGAAATAAAAATAAATATGGG - Intronic
1144009449 17:11132721-11132743 ATGTGAATAAAAATCAAGGAAGG - Intergenic
1144114777 17:12077351-12077373 CTGGGAAATAAAATAATGCTAGG + Intronic
1144635685 17:16907441-16907463 CTGTGGAGAGAAATAAAGCAGGG + Intergenic
1145203246 17:20966242-20966264 CTGTGGAGAGAAATAAAGCAGGG + Intergenic
1146112017 17:30098368-30098390 CTTGGAAAAAAAAAAAAGCTGGG + Intronic
1146139224 17:30350366-30350388 CTCTTAAAAAAAAAAAAGCTGGG - Intergenic
1146270322 17:31480862-31480884 CTCTGAAGAAAAACAAAGCAGGG - Intronic
1146815505 17:35938891-35938913 CTATGAAGAAGAATAAAGCAGGG - Intronic
1147320433 17:39642696-39642718 CTGTGAAGAAAAATACAGCAGGG + Intronic
1148026029 17:44588280-44588302 ATATGAATAAAAATAAAGTCTGG - Intergenic
1148134883 17:45285789-45285811 CTATTAAAAAAAATATAGCTGGG + Intronic
1148727066 17:49800789-49800811 CTGTGAAGGAAAATGAAACTGGG + Intronic
1149034495 17:52118812-52118834 CTGTGAATAAAAAAAATTCTAGG - Intronic
1149559779 17:57600338-57600360 CTGTGAATATAAAAAAATCATGG - Intronic
1149780979 17:59396419-59396441 CAGTGAAGAAAACTAAAGCAGGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150759913 17:67952422-67952444 CTGAAAATAGAAAAAAAGCTGGG - Intronic
1151806474 17:76408785-76408807 TTGTGAACAAAACTAAACCTTGG + Intronic
1153270663 18:3318176-3318198 CTGTGAAACACAATAAAGCAAGG + Intergenic
1153492712 18:5666067-5666089 CTGGAAATAGAAATAGAGCTTGG - Intergenic
1153748748 18:8208438-8208460 CTATGGAGAAAAATAAAGCTGGG + Intronic
1153898710 18:9594877-9594899 CTGTGATTATGAATAAAACTTGG + Intronic
1154235984 18:12606151-12606173 CTATGAAGAAAAATAAAGGGGGG - Intronic
1155042040 18:22072988-22073010 CAGTGAAAAAAAATAATGTTAGG - Intergenic
1155135241 18:22985361-22985383 CTCTGAAGAAAAGTAAAGCAGGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155383834 18:25254817-25254839 CTGTGTATGAAAAGAAAGGTGGG - Intronic
1155783129 18:29864440-29864462 CTGTAATGAAAAAAAAAGCTAGG - Intergenic
1156156750 18:34312494-34312516 CTGGGAAGAAAAATAAATCTAGG + Intergenic
1156771180 18:40728294-40728316 AAATGAATAAAAATAAATCTTGG + Intergenic
1157199855 18:45650898-45650920 CTAAAAATAAAAAAAAAGCTGGG - Intronic
1157350101 18:46876379-46876401 CTGTAAATAAAAATGTAGATTGG + Intronic
1158185129 18:54762762-54762784 CTGAGAAGAATAATAAAGCAGGG - Intronic
1158258564 18:55582632-55582654 GTGAGAATAAAAATAAAGTGTGG - Intronic
1158379592 18:56914301-56914323 CTGTGAAGAAAAATAAAGCAGGG - Intronic
1158442377 18:57488459-57488481 CTGTGATTAAAAAAAGGGCTGGG - Exonic
1158524779 18:58202797-58202819 ATGAGAAAATAAATAAAGCTAGG - Intronic
1158625288 18:59066099-59066121 TAGTGAATAAAGATAAAGCAGGG + Intergenic
1159151314 18:64527203-64527225 CTGTTATTCAAAAGAAAGCTAGG + Intergenic
1159388796 18:67761127-67761149 ATGTGAAGAACAATAAAGCAAGG - Intergenic
1159508704 18:69368032-69368054 CTCTGAAGAAAAATAAAGGGCGG - Intergenic
1159788649 18:72747870-72747892 CTGACAATAAAAATAAAGTTGGG + Exonic
1160282658 18:77507106-77507128 GTGTCAATAAAAATAAAGACTGG + Intergenic
1160444900 18:78919771-78919793 ATGTGAATGAAAATAAAGACGGG + Intergenic
1160882833 19:1329991-1330013 CTGAAAGTAAAAATAAGGCTGGG - Intergenic
1161035997 19:2084887-2084909 CTCTAAATAAAAAAAAAACTAGG - Intronic
1161827396 19:6577563-6577585 CTCTGAATGTAAAGAAAGCTTGG + Intergenic
1162334307 19:10050858-10050880 CCCTGAATAAACATAGAGCTGGG + Intergenic
1162542461 19:11305965-11305987 CTGTGAATAAAAACAAGGCAGGG + Intronic
1162595816 19:11628296-11628318 CTGTTAAAAAAAAAAAAGCCGGG - Intergenic
1163376529 19:16936221-16936243 CTAAGATTAAAAATAGAGCTGGG - Intronic
1163706448 19:18816783-18816805 CTGAGAATAAAAACAGTGCTTGG - Intergenic
1164019417 19:21285483-21285505 ATCAGAATAAAAATAAGGCTGGG - Intronic
1165225239 19:34350098-34350120 CTCTGAAGGAAAATAAAGCAGGG + Intronic
1166197229 19:41215133-41215155 CAGTGAAGAAAAATAAAGCAAGG - Intergenic
1166556949 19:43706545-43706567 CTCAGAAAAAAAAAAAAGCTTGG + Intergenic
1166668663 19:44697017-44697039 CTGTGGAGAAAAATAAAGCAGGG - Intergenic
1167418907 19:49391255-49391277 CTGTGAAGAGAAATGAAGCGGGG - Intronic
1167531972 19:50023521-50023543 CTGTGAAGAAAAATAAAGCAAGG - Intronic
1168486652 19:56768241-56768263 CTATGAAGAAAAATAAAACCAGG - Intergenic
1168513180 19:56989706-56989728 CTATGAAGAAAAATACAGCAGGG + Intergenic
1168524213 19:57075802-57075824 GCGTGAATGAAAATACAGCTGGG - Intergenic
924958802 2:14956-14978 CTGTGACAAAAAAAAAAGCAGGG + Intergenic
925038309 2:709150-709172 GTGTGTATAAAAATACAGCGTGG - Intergenic
925558181 2:5154830-5154852 CTGTGAAAGCAAATTAAGCTAGG + Intergenic
926305311 2:11633801-11633823 CAGCAAATAAAAATAAAGCTAGG - Intronic
927097549 2:19759123-19759145 CAGTGAATAAAAAAAGACCTCGG + Intergenic
927161272 2:20264907-20264929 CAATGAAAAAAAGTAAAGCTAGG - Intronic
927795738 2:26047075-26047097 AAATGAATAAAAATAAAACTGGG - Intronic
927832780 2:26367880-26367902 CTATGGAGAAAAATAAAGCAGGG - Intronic
928768817 2:34680040-34680062 TTATGAATAAAAATGAAACTAGG + Intergenic
929487436 2:42367478-42367500 CTATAAAGAAAAAAAAAGCTAGG + Intronic
930038446 2:47102540-47102562 CTCTCAATGAAAAGAAAGCTCGG - Intronic
930140450 2:47946336-47946358 CTATGGAGAAAAATAAAGCAAGG + Intergenic
930207325 2:48601392-48601414 CTATGCAGAAAAATAAAGCAGGG + Intronic
931010005 2:57899933-57899955 CTGTGAATAATTAAAAAGCAGGG - Intergenic
931324471 2:61204602-61204624 CTGAAAATAAAAACAAAGTTTGG + Intronic
931667883 2:64623321-64623343 CTGTGAAGAAAAAGAAGGCGAGG + Intergenic
931856057 2:66302908-66302930 CTATGAAGAAAAATTAAGCAGGG + Intergenic
932290104 2:70569899-70569921 TTGGGAATGAAGATAAAGCTTGG + Intergenic
932802623 2:74755144-74755166 ATTTGGAAAAAAATAAAGCTTGG + Intergenic
932834611 2:75024402-75024424 CTGTGAAAGAAAATAAAACAGGG - Intergenic
932910040 2:75796821-75796843 CTGTGAACAAAAATGAAGCTGGG + Intergenic
933130132 2:78662141-78662163 ATGTGAATCAAAAGAAAGTTGGG - Intergenic
933466009 2:82653095-82653117 CTGCTATCAAAAATAAAGCTTGG - Intergenic
933627067 2:84613099-84613121 CTATGAAGAAAAATAAAGTAGGG + Intronic
933654685 2:84878050-84878072 CTATAAATAAAAATAAAGCAGGG + Intronic
933885454 2:86715838-86715860 CTGTTAATAAAAATGAATCAGGG - Intronic
934082592 2:88481969-88481991 CCTGAAATAAAAATAAAGCTTGG + Intergenic
935138240 2:100327118-100327140 ATGCTAACAAAAATAAAGCTAGG + Intergenic
935153346 2:100460128-100460150 ATGTGAAAGAAAATAAATCTTGG + Intergenic
936453539 2:112652014-112652036 CTGTGAAGAGAAATAAAGAAGGG - Intronic
936892684 2:117391075-117391097 CTGAGAAAAAAAATAAAAATAGG + Intergenic
937013050 2:118578635-118578657 CTATGAAGAAAAATAAAGCTTGG - Intergenic
937081156 2:119140942-119140964 CTGTAAAGAAAACTGAAGCTAGG + Intergenic
937417337 2:121726351-121726373 CTCTTAAAAAAAAAAAAGCTGGG - Intergenic
937503964 2:122515233-122515255 CTTTGGGAAAAAATAAAGCTAGG + Intergenic
937864555 2:126739188-126739210 CTCTGAACAAAAATACAGCTTGG + Intergenic
938861991 2:135378950-135378972 ATATAAATAAAAATAAAACTAGG - Intronic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
939338636 2:140864000-140864022 CAGTGAGTAAAACAAAAGCTTGG + Intronic
939363667 2:141206097-141206119 CTGTGAATAAAAATAATGTGAGG + Intronic
940296505 2:152130689-152130711 CTTTAAAAAAAAAAAAAGCTGGG + Intronic
940538107 2:154972334-154972356 CTATAAATAAAAATAAAGTAAGG + Intergenic
940799224 2:158115078-158115100 CTGTTAATAAAAATAAACAAGGG - Intronic
941480665 2:166006167-166006189 ATGTGAATAAAAATAAAAGTGGG + Intronic
941501099 2:166277395-166277417 CTTTGAACAAAAATCAAGATTGG - Intronic
941585350 2:167351443-167351465 CTGACAATAAAAATAAGCCTTGG + Intergenic
941778145 2:169415028-169415050 GGGTAAATAATAATAAAGCTGGG - Intergenic
941807657 2:169725075-169725097 CTATGGATTAAAATAAAGCAGGG + Intronic
942213874 2:173699015-173699037 ATGTGAAAGAAAATAAATCTGGG + Intergenic
942363082 2:175193338-175193360 CTCTGAAGAAATATAAAGATAGG - Intergenic
942443643 2:176062273-176062295 CTATGAAAAAAAACAAAGCAAGG + Intergenic
942509945 2:176687300-176687322 CTGTTATTAATAATAAAGGTCGG + Intergenic
942513209 2:176724456-176724478 CTGTGAGTAGAAATTAAGTTAGG + Intergenic
943008033 2:182410573-182410595 GTGTTAAGAAAAATACAGCTGGG + Intronic
943419860 2:187656733-187656755 CTGTGAATAACAAAAAATCCAGG - Intergenic
943703328 2:191010320-191010342 CTATGAAGAAAAATAAACCAGGG - Intronic
943745669 2:191460421-191460443 TTGTGAAAAAAACTAAAGCATGG - Intergenic
943988356 2:194653532-194653554 AAGTGAACAAAAATTAAGCTAGG + Intergenic
944415393 2:199474854-199474876 ATATGAATAAAAACAAACCTCGG + Intergenic
944808286 2:203303782-203303804 ATGAGAAAAAAAATAAACCTGGG + Intronic
945227841 2:207550855-207550877 GCGTGTAGAAAAATAAAGCTGGG - Intronic
945569702 2:211450781-211450803 CTCTGATGAAAAATAAAGCAGGG - Intronic
945760310 2:213905717-213905739 CTATGAAGAAAAATAAAGCAGGG + Intronic
945848681 2:214979478-214979500 CTATGGATAGAAATAAAGCAGGG - Intronic
945928438 2:215829817-215829839 TTGTGATTAAAAATGAACCTTGG + Intergenic
945952143 2:216049374-216049396 CTGTGTTTAAAAATAAAACAGGG + Intronic
946314709 2:218902959-218902981 CTATGAAGAAAAATAAAGCAAGG - Intergenic
946669272 2:222085071-222085093 CTATGAAGAAAAATAAAACAAGG - Intergenic
947029501 2:225777003-225777025 CTGTGAATAAATATAATTTTTGG + Intergenic
947190616 2:227501087-227501109 CTGTCAAAAAAAATTAGGCTGGG - Intronic
947846800 2:233251364-233251386 CTGCGATTAAAAATAAAAGTGGG + Intronic
948017000 2:234699251-234699273 CTCTGAGGAAAAGTAAAGCTGGG + Intergenic
1168819996 20:766233-766255 CTGCTAATAAAAAGACAGCTTGG - Intronic
1168863698 20:1065257-1065279 CTAAGAAGAAAAATAAAGCAGGG - Intergenic
1169358188 20:4925364-4925386 CTGTGAAGAAAAATAAATCAGGG - Intronic
1169440859 20:5632748-5632770 AGGTGAATAAAAATAAAGAATGG - Intergenic
1169610508 20:7374755-7374777 CTCTGAACAACAATAATGCTAGG - Intergenic
1169792647 20:9428024-9428046 CTATGATTAAAAATACATCTTGG + Intronic
1170442330 20:16391514-16391536 CTATGAAAAAGCATAAAGCTGGG + Intronic
1170530119 20:17282746-17282768 CTGTGAAAAAAAAAAAAGAAAGG + Intronic
1170843091 20:19939779-19939801 CTATGAAGAAACATAAAGCCAGG - Intronic
1170968326 20:21096141-21096163 CAGTTAAGAAAAATAAAGCCAGG + Intergenic
1171471608 20:25376607-25376629 CTATAAAGAAAAATAAAGCAAGG - Intronic
1171566727 20:26200135-26200157 CTTTAATAAAAAATAAAGCTGGG + Intergenic
1172499272 20:35413414-35413436 CAGTGAAAAAAATTAAAACTGGG + Intergenic
1172503545 20:35444269-35444291 CTGTGAAGAAAAATTAAGCAGGG + Intronic
1172549784 20:35789858-35789880 CTGTGTATAAAAAAAAAGGGGGG - Intronic
1172551049 20:35800200-35800222 CTATGATTAAAAAAAAATCTGGG + Intronic
1172669633 20:36626096-36626118 CTTTAAAAAAAAATACAGCTGGG + Intronic
1172925393 20:38529534-38529556 ATAAAAATAAAAATAAAGCTTGG + Intronic
1173722473 20:45271634-45271656 ATATGCATAAAAATAATGCTGGG - Intergenic
1174287902 20:49484851-49484873 CTAAGAAGAAAAATAAAGCGAGG + Intergenic
1174410106 20:50329829-50329851 CTAGGAATAAAAATAAACCTAGG - Intergenic
1174495561 20:50939181-50939203 CTGTGAAGAAAAACACAGCAGGG - Intronic
1175585710 20:60138070-60138092 GTGATAATAAAAATATAGCTTGG - Intergenic
1177134987 21:17298750-17298772 CCTTCAATAAAAAGAAAGCTTGG - Intergenic
1177944258 21:27447529-27447551 CTCTGAATAAATATAAAGCCAGG - Intergenic
1178047164 21:28708648-28708670 CTATTAACAAAAATAATGCTAGG + Intergenic
1178167756 21:30000678-30000700 ATGTGAAAAAAAAAAAAGATAGG + Intergenic
1178191683 21:30289393-30289415 CAGCGACAAAAAATAAAGCTCGG + Exonic
1178350116 21:31866891-31866913 CTGTGAAGGAAAATAAAGCAGGG + Intergenic
1178375727 21:32066034-32066056 ATGTCAATAATAATTAAGCTGGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178481387 21:32982426-32982448 CTGAGAAGAAAAATAAAGGAGGG + Intergenic
1178844286 21:36161435-36161457 CTGTTAAAAAAAATAAAACTAGG - Intronic
1180578655 22:16807117-16807139 ATGTGAATAAACATAAAATTTGG - Intronic
1181078631 22:20399064-20399086 CTGGGAAATAAAATAAATCTTGG - Intronic
1181375966 22:22458294-22458316 CTGTAAATAAAAATGTAGATTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182373993 22:29832744-29832766 CTTTAAAAAAAAAAAAAGCTGGG - Intronic
1183089713 22:35513518-35513540 CTATGAAGAAAAATAAATCAGGG + Intergenic
1183238926 22:36641158-36641180 CTCTGCAGAAAAATAAAGCAGGG - Intronic
949617397 3:5769016-5769038 CTGAGATTCAAAATAAAGGTGGG - Intergenic
950068088 3:10129656-10129678 CTGTCTTTAAAAATTAAGCTTGG + Intergenic
950337243 3:12205945-12205967 CTGTGGAGAAAAATAAAGCCAGG - Intergenic
951491618 3:23275798-23275820 CTGTGACAAAAAAAAAAGTTGGG - Intronic
951586789 3:24222893-24222915 ATGTGACCAAAAATAAAACTTGG - Intronic
951589892 3:24253053-24253075 CAGTGAATACAAATAAAGGTGGG + Intronic
951690681 3:25392625-25392647 CTGTGAAAAAAAATATACATAGG - Intronic
952128684 3:30333887-30333909 ATATTAATAAAAATAAATCTGGG + Intergenic
952422345 3:33143664-33143686 CTGTGGAGAAAAATAAAGCAGGG + Exonic
952437681 3:33288428-33288450 CTTTGGAGAAAAATAAAGCTGGG + Intronic
952705043 3:36368735-36368757 GCGTGAAGAAAAATAAAACTTGG - Intergenic
952770659 3:36996989-36997011 CTGTGGAGAAAACTAAAGCAGGG + Intronic
952790037 3:37193057-37193079 CTGTTAGTATAAATAAACCTGGG + Intergenic
953488369 3:43324973-43324995 CTGGGGATAAAAATCAAGCAAGG - Intronic
954086464 3:48247874-48247896 CTCTGAATTAAAATTAAACTTGG - Intronic
954090147 3:48277714-48277736 CTATTAATAAAAATGTAGCTTGG + Intronic
954586610 3:51742044-51742066 CTGTAAATAAAAATGTAGATTGG + Intergenic
954766116 3:52918130-52918152 CAGTGGAAAAAAATAAAGCTGGG - Intronic
955295243 3:57728970-57728992 CTGTGGAGAAAAATGAAGCAGGG + Intergenic
956369360 3:68541655-68541677 CTCAGGATAAAAATAAAGTTGGG + Intronic
956392621 3:68789596-68789618 CTATGGGGAAAAATAAAGCTGGG - Intronic
957111356 3:75963345-75963367 CTTTAATAAAAAATAAAGCTGGG - Intronic
957416073 3:79907165-79907187 CTGTAAATAAAATTAAAACCTGG - Intergenic
957500017 3:81043641-81043663 CTTTGAATAAAAATAACGTCCGG - Intergenic
957618878 3:82569353-82569375 CTGTAAATAGAAATCAAACTGGG - Intergenic
957989068 3:87608151-87608173 CTGTAAATAAAAATGTAGATTGG - Intergenic
958429417 3:94020000-94020022 ATGCTAAGAAAAATAAAGCTGGG - Intronic
958576604 3:95957555-95957577 GTGTGAATAAAAACAAAGAAGGG - Intergenic
958703790 3:97627324-97627346 CTGTGGAGAAAAATAAAGCAGGG + Intronic
958766182 3:98370996-98371018 TTAATAATAAAAATAAAGCTGGG - Intergenic
958967874 3:100579388-100579410 ATATGAAGAAAAATAAAGCTGGG + Intergenic
959602519 3:108203794-108203816 CTGTGAGGAAAAATAAAGTAGGG + Intronic
959864539 3:111251307-111251329 CTGTGGGTCAAAATAAAGCAAGG - Intronic
959938160 3:112052115-112052137 CTATGGAGAAAAATAAAGCAGGG + Intronic
960093354 3:113664690-113664712 CTATGAAGAAATATAAAGCAGGG + Intronic
960308720 3:116094308-116094330 GTGTGAAAAGAACTAAAGCTAGG - Intronic
960449895 3:117793770-117793792 CTGTGATTTTAATTAAAGCTTGG - Intergenic
960535501 3:118810400-118810422 CTTTGGAAACAAATAAAGCTGGG + Intergenic
960592193 3:119377309-119377331 CTATGAAGAAAAATAATGCAGGG + Intronic
960718192 3:120598554-120598576 ATGAGAAAAAAAATAAAGCAGGG + Intronic
960739954 3:120822188-120822210 CTGTGGAGAAAAATAAAGCAGGG + Intergenic
960926445 3:122799233-122799255 CTTTGGAGAAAAATAAAGCAGGG + Intronic
961069747 3:123911573-123911595 CTGTGAAGAAAAATAAAGCAGGG - Intronic
961267771 3:125659862-125659884 CTGAGAATGAAAAACAAGCTAGG + Intergenic
961575790 3:127835076-127835098 CTGTGGGTCAAGATAAAGCTTGG + Intergenic
961865063 3:129947970-129947992 CAGTGACGAAAAATAAAGCTAGG + Intergenic
961931184 3:130534724-130534746 CTGTGAAAAAAAATAACCCAGGG - Intergenic
962221629 3:133569227-133569249 CTGTAAATAAATGAAAAGCTTGG - Intergenic
962480914 3:135797613-135797635 CTGTGAATAGGAATAAAACTTGG + Intergenic
962731930 3:138291614-138291636 CCATGAAGAAAAATAAAGCAAGG + Intronic
963084466 3:141424042-141424064 TGATGAATAAAAACAAAGCTAGG - Intronic
963119674 3:141765406-141765428 CTGTGAAGAAAAATCAAGCAGGG - Intergenic
963882532 3:150545486-150545508 CTGTGAGTACAAATTAAGCTGGG + Intronic
964022846 3:152035020-152035042 ATGTGAAAAAAAATAAATCTTGG - Intergenic
964108282 3:153062444-153062466 CTGGGAAGATAAATAAAGATGGG - Intergenic
964434242 3:156635290-156635312 CTATGAAGAAAAATGAAGCAGGG - Intergenic
964918934 3:161872224-161872246 ATGTAAATAAAATTAAAGCTTGG + Intergenic
964972161 3:162576489-162576511 CGCTCAATGAAAATAAAGCTTGG - Intergenic
965056713 3:163727405-163727427 CTTTTAATAAAAATAAATGTAGG + Intergenic
965785709 3:172332384-172332406 CTATGACAAAAACTAAAGCTAGG - Intronic
966195221 3:177306884-177306906 CTAAGAATTAAAATAAGGCTGGG + Intergenic
966306103 3:178536659-178536681 CTGTCATTAAAAATTAAGCGTGG + Intronic
966681703 3:182648420-182648442 GTATGAAGAAAAATAAAGCAAGG - Intergenic
966984585 3:185167551-185167573 CTGTAAAAAAAAAAAAAGGTAGG - Intergenic
967184939 3:186936636-186936658 CTGATTATAAAAATAAAGCTAGG + Intronic
967337957 3:188365211-188365233 CTGCCATTAAAAATAAATCTGGG + Intronic
967762312 3:193240527-193240549 GTGAGTTTAAAAATAAAGCTGGG - Intergenic
968277003 3:197447478-197447500 CTGTAAAGAAAAATAGAGCCAGG - Intergenic
968691863 4:1994558-1994580 CTGTCAAAAAAAAAAAAGCCGGG + Intronic
968751614 4:2392571-2392593 CAGTGAATAAAAATAAATTAAGG + Intronic
969030251 4:4206309-4206331 CTGTGCAGAAAAATAAAGTGAGG + Intronic
969083753 4:4640311-4640333 CTATAAATAAAAATAAAAATGGG + Intergenic
969363731 4:6681783-6681805 CTGAGAATAATGAAAAAGCTGGG - Intergenic
970026487 4:11629600-11629622 CTATGAATAAAAACAAAGCAGGG + Intergenic
970043159 4:11819787-11819809 GTGAGAATAAAGATGAAGCTTGG + Intergenic
970881245 4:20934745-20934767 CTATGTAGAAAAATAAAGCAAGG + Intronic
971244470 4:24915599-24915621 CGGTATTTAAAAATAAAGCTGGG + Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972172638 4:36365457-36365479 CTGTGGGTAAAAATGAAGGTAGG + Intergenic
972247593 4:37261762-37261784 CTGTGAAGAAAAACGAAGCAAGG + Intronic
972411490 4:38799993-38800015 CTGTAGAGAAAAATAAAGCAGGG + Intronic
972612943 4:40672072-40672094 CTATGAAGAAGAATAAAGCAGGG + Intergenic
973000460 4:44942342-44942364 CTGTGAAGTAAAATAAAGCAAGG - Intergenic
973007227 4:45028206-45028228 CTGTGGTGAAAAATAAAGCAAGG + Intergenic
973042390 4:45486764-45486786 CTATGAATAAAAATAAATAAAGG - Intergenic
973533588 4:51858036-51858058 CTGTGAAGAAAAGCAAAGCATGG + Intronic
973671263 4:53220175-53220197 CTATGAAGAAAAATGAAGCTGGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974293039 4:59959147-59959169 CTATAAATAAAAATAAGGCCAGG + Intergenic
974470886 4:62316290-62316312 CTGGGAAAAAAAAAAAAGCAGGG - Intergenic
974639422 4:64609433-64609455 ATGTGATTAAAAGTAAAGTTAGG + Intergenic
975547174 4:75571558-75571580 CTGGGTGTAAAAATAAAGCTGGG - Intergenic
975738666 4:77406893-77406915 CTGTTAAAAAAAACAAAGCCTGG + Intronic
976038450 4:80853392-80853414 CTGTGAACAAAAATAAAACAAGG + Intronic
976404323 4:84644872-84644894 TTGTGGTTAAAAAGAAAGCTAGG + Intronic
976796061 4:88934212-88934234 CTGTGAAGTAAAATAAAGCAGGG - Intronic
977083733 4:92567990-92568012 CTATGAAGTAAAATAAAGCAGGG + Intronic
977166278 4:93702893-93702915 CTATGGATAAAAATGAAGCAAGG + Intronic
977296400 4:95214309-95214331 CTGTTTATAAAAATGAAGCTAGG - Intronic
977531757 4:98208521-98208543 TTGTTAAAGAAAATAAAGCTTGG + Intergenic
977590888 4:98825472-98825494 CTATGTTGAAAAATAAAGCTAGG + Intergenic
977884008 4:102237280-102237302 CCTTCAATAAAAAGAAAGCTTGG - Intergenic
978091584 4:104723881-104723903 CTATTAATCAAAACAAAGCTAGG + Intergenic
978119130 4:105057211-105057233 TTATGAATAAAAATTAAGCAGGG + Intergenic
978450489 4:108827891-108827913 CTGTGAAATAAAATATAGCTGGG - Intronic
978513045 4:109542330-109542352 TTATGAAGAAAAATAAAGCTCGG + Intergenic
978631674 4:110754246-110754268 CTAAGAAGAAAAATAAAGCAGGG + Intergenic
978752724 4:112270687-112270709 CTGTGAATAAAAAGACCACTGGG + Intergenic
978789189 4:112643218-112643240 CTATGAACAAAAATAAGGCAGGG + Intronic
978822556 4:112982136-112982158 CTGTGAATTAAAAAAGAGTTTGG + Intronic
978875779 4:113638914-113638936 TTCTGATTAACAATAAAGCTAGG - Intronic
979037618 4:115745275-115745297 AAATGTATAAAAATAAAGCTTGG - Intergenic
979107767 4:116709113-116709135 CTGTGAATCTAAATAAACCCAGG - Intergenic
979235112 4:118391123-118391145 TTATGAAGAAAAATAAAGCCGGG + Intergenic
979736287 4:124089964-124089986 CTGGTAATAAAATTCAAGCTTGG - Intergenic
980263146 4:130480460-130480482 CTGTGTAAAAAAATAAATATGGG + Intergenic
980290981 4:130847243-130847265 CCTTCAATAAAAAGAAAGCTTGG + Intergenic
980555919 4:134404600-134404622 ATGTATATAAAAATATAGCTGGG - Intergenic
980605990 4:135090232-135090254 ATGTGACTAAAAGTAAAGATGGG + Intergenic
980834927 4:138179358-138179380 ATGTGAAGGAAAACAAAGCTGGG + Exonic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981647776 4:147019623-147019645 CTGTGCAGAAAAATAAAGGATGG - Intergenic
981874899 4:149530173-149530195 CTATGAAGAAAACTAAAGCAAGG - Intergenic
982108594 4:152032811-152032833 CTTTGAAGAGAAATAAAGCAGGG + Intergenic
982276823 4:153644439-153644461 CTTTAAAAAAAAAAAAAGCTGGG - Intergenic
982326217 4:154130781-154130803 CTGTGAATAAAAATAGTTTTAGG - Intergenic
982370710 4:154629678-154629700 CTGTGGAGAAAACTAAAGCCAGG - Intronic
982479365 4:155890765-155890787 CTATGAAAAAAAATAAAGCAGGG - Intronic
983019256 4:162654883-162654905 CTGTGAAGAAAAATAAACCAGGG + Intergenic
983098279 4:163592613-163592635 CTGTGAATTCAAATAAGACTTGG - Intronic
983244903 4:165276505-165276527 CAGTGAAAAAAAAAAAAGTTAGG - Intronic
983505715 4:168551568-168551590 ATGTGGATAAAAACAAACCTGGG + Intronic
983863175 4:172733797-172733819 CTGTGAATAAATACATACCTGGG - Intronic
983874294 4:172858359-172858381 CTGTGAGTAAATATAAAGCAAGG + Intronic
983890351 4:173023738-173023760 ATCTGATTAAAAATGAAGCTGGG + Intronic
984003147 4:174275342-174275364 CACTGAGTAAAAATAAAACTAGG + Intronic
984721091 4:182973919-182973941 CTATGAAGAAAAATAAAGCAGGG + Intergenic
985187846 4:187336890-187336912 CTAAGTATAAAAATAAATCTTGG - Intergenic
985239847 4:187918576-187918598 CTATGAAGAAAAGTAAAGCTGGG + Intergenic
985312922 4:188622045-188622067 CTCAGAATCAAAACAAAGCTTGG + Intergenic
985349461 4:189042553-189042575 ATGTGAATAAAAATAGAAATAGG + Intergenic
985412759 4:189703466-189703488 ATGTGAATAAAAATAAAACTAGG + Intergenic
985699164 5:1360299-1360321 CTGTGGAAAAAGAAAAAGCTAGG + Intergenic
986068819 5:4262648-4262670 CAGGGAATAAAAATAAAACTAGG - Intergenic
986615683 5:9615021-9615043 CTGTGAAGAAAAATACATGTAGG + Intergenic
987018396 5:13844693-13844715 CAGTGACTAAAAACAAATCTCGG - Intronic
987444510 5:18001196-18001218 CTGTGAATAAACTTAGAGTTAGG + Intergenic
987643252 5:20638221-20638243 CTGTGAAAAAAAATAATTATTGG - Intergenic
987977956 5:25040007-25040029 TTCCAAATAAAAATAAAGCTTGG - Intergenic
988869721 5:35375786-35375808 CTGTGCATAGAAATCAAGGTTGG - Intergenic
989048222 5:37294466-37294488 CTGGGAAGAAAAAAAAAGATCGG + Intronic
989976039 5:50588430-50588452 ATTTGAGTAAAAATAAATCTCGG - Intergenic
989992779 5:50787512-50787534 CTCTGGAGAAAAATAAAGATGGG - Intronic
990135463 5:52639176-52639198 GAGTGAATAAAATTATAGCTTGG - Intergenic
990318451 5:54606803-54606825 ACGTGAGTACAAATAAAGCTGGG - Intergenic
990793988 5:59519319-59519341 CTATGAATAAAAATACAGCAGGG + Intronic
990827187 5:59914261-59914283 CTGTGGAGAAAAACAAAGATGGG + Intronic
990910432 5:60846207-60846229 CTATGAAGAAAAATAAAGAAGGG + Intergenic
991207134 5:64062028-64062050 GTTAGAAGAAAAATAAAGCTGGG - Intergenic
991224521 5:64254608-64254630 CTATTAATAAAAATATAGATAGG + Intronic
991954228 5:71976365-71976387 CAATGAAGAAAAATAAAGCAGGG - Intergenic
992049274 5:72928284-72928306 CTTTCAATGAAAAGAAAGCTTGG - Intergenic
992062964 5:73075198-73075220 CTATGAAGAAAAATAAACCAGGG + Intronic
992793382 5:80233577-80233599 TTAAGAATAAAAATAAAACTAGG + Intronic
992877719 5:81074300-81074322 CTGTGGAGAAAAATAAAGAAGGG + Intronic
993204504 5:84862750-84862772 CTGTGAAGGAAAATAAAACTAGG + Intergenic
993490868 5:88546958-88546980 CAGTGATTCAAAATAAAACTGGG - Intergenic
993611018 5:90054366-90054388 ATTTGAATAAAAATCAAGTTAGG + Intergenic
993641155 5:90408075-90408097 GTGGGAATAAATAAAAAGCTGGG - Intronic
993677930 5:90839764-90839786 CTATGAAGAAAAATAAAAGTAGG - Intronic
994261602 5:97665774-97665796 CTGTGAGCAGAAATGAAGCTTGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994893851 5:105675192-105675214 CTGAGTGGAAAAATAAAGCTTGG + Intergenic
995118000 5:108503299-108503321 GTATGAAGAAAAATAAAGCATGG - Intergenic
995584130 5:113629288-113629310 ATCTCAAGAAAAATAAAGCTAGG - Intergenic
996249084 5:121304663-121304685 CTATGAAACAAAATAAAGTTTGG + Intergenic
996998378 5:129726836-129726858 CTATGGAAAAAATTAAAGCTGGG - Intronic
997132852 5:131294586-131294608 CTATGAGGAAAAATAAAGCATGG + Intronic
997373239 5:133376369-133376391 ATGTGAAAAATAATAAAACTAGG + Intronic
997944528 5:138187914-138187936 CTGGGAATAAGAATAAAGTCTGG + Exonic
998075620 5:139233843-139233865 CTTTGAAGAAAAATAAAGCCAGG + Intronic
999227881 5:150042354-150042376 CTGTGAAGCACAGTAAAGCTGGG + Intronic
999551761 5:152695264-152695286 CTGAGAAGAAAAATGAGGCTGGG - Intergenic
999628342 5:153543926-153543948 CTGTGGGAAAAAATAAAGCATGG + Intronic
1000245067 5:159442293-159442315 CTATGAATAAAGATAATGCAGGG + Intergenic
1000793792 5:165639582-165639604 CTCTGAATAAAAATAAAATTTGG - Intergenic
1001666827 5:173440112-173440134 GTGTGTATAAAAATACAGTTTGG - Intergenic
1002913166 6:1506551-1506573 CTATGAAGTAAAATAAAGCCAGG - Intergenic
1002934992 6:1663821-1663843 CCATGAAGAAAAATAAAGCAGGG - Intronic
1003963947 6:11235551-11235573 CTATGAAGAAAAATTAAGCAGGG + Intronic
1004589928 6:17040500-17040522 TTGTAATTAAAAATAAAGTTAGG + Intergenic
1004755549 6:18606760-18606782 CTATGAATAAAAATAAAGTGGGG - Intergenic
1005457656 6:26036536-26036558 CTGTGGAGAAAAATAAAGAAAGG + Intergenic
1005772852 6:29093435-29093457 CTATGAAGAAAAAGAAAGCAGGG + Intergenic
1005979054 6:30822255-30822277 CTGTGTATAAAAAGCCAGCTAGG - Intergenic
1006472352 6:34236081-34236103 CTGTAAATAAAAATAAAAGGTGG - Intergenic
1006753396 6:36393813-36393835 CTTTGGAGAAAAATAAAGCAAGG - Intronic
1006845259 6:37057105-37057127 CTGTGGAGAAAAATAAAGGCAGG + Intergenic
1007880335 6:45158442-45158464 CTGGCAATAAAAGTAAATCTTGG + Intronic
1007943254 6:45801888-45801910 AAGAGAAAAAAAATAAAGCTGGG - Intergenic
1008587093 6:52960072-52960094 CTGTCAATGAAAAGAAAGCTTGG + Intergenic
1008812913 6:55526821-55526843 CTCTGAATAAAAATAAAATTAGG + Intronic
1010706138 6:79113078-79113100 CTATTAAGAAAAATAAAGCTAGG - Intergenic
1011035763 6:82972671-82972693 ATGTACATAAAAATATAGCTTGG + Intronic
1012018715 6:93888342-93888364 CCCTCAATAAAAAGAAAGCTGGG + Intergenic
1012304515 6:97636215-97636237 CTGTGAAGCATAATAAAGCAGGG - Intergenic
1012615750 6:101277774-101277796 CTATGAAGAAAAAGAAAGATGGG + Intergenic
1012997813 6:105991290-105991312 CTGTATATAAAAATAAAGCATGG + Intergenic
1013388471 6:109657393-109657415 CTAGGAAGAAAAATAAAGCAGGG + Intronic
1013629661 6:111973927-111973949 CTCCAAATGAAAATAAAGCTTGG - Intergenic
1014211193 6:118709946-118709968 CAGTGAATAAAAATAAATCAGGG + Intronic
1014291401 6:119562911-119562933 CTGTGAATAAAAGAAGAGTTAGG - Intergenic
1014980587 6:127941930-127941952 CTATGGAGAAAAATAAAGCAGGG - Intergenic
1015037369 6:128672421-128672443 CTGAGTATATAAAGAAAGCTTGG + Intergenic
1015144827 6:129973674-129973696 CTGTGAATAACAATAAAACCAGG - Intergenic
1015391251 6:132684641-132684663 TTGTTAATGACAATAAAGCTAGG + Intronic
1015989308 6:138919751-138919773 CTGTGAATAAAAATAAAGCTGGG - Intronic
1016596077 6:145802859-145802881 ATCTGAATAAAAATAAAGGGGGG + Intronic
1016835458 6:148472418-148472440 TTGTGATTCAAAATAAACCTTGG + Intronic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017339186 6:153300763-153300785 CTGTAAATAACAATAAAGTTTGG - Intergenic
1017368232 6:153670295-153670317 TTGTGAAGGAAAATAAATCTTGG - Intergenic
1018189551 6:161298293-161298315 TTGTTAATAAAAATAAGGATTGG + Intergenic
1018208155 6:161454906-161454928 TTATGAAGAAAAATATAGCTGGG - Intronic
1018269360 6:162059013-162059035 CTGTGAAGCAAAATATAACTGGG - Intronic
1018376758 6:163219969-163219991 TTGTGAAGCAAAATAAAGCAAGG - Intronic
1018522014 6:164659777-164659799 CTGTGGACATAACTAAAGCTAGG + Intergenic
1018770609 6:166968188-166968210 CTTTCAAAAAAAATAAAGATAGG + Intergenic
1020673297 7:11147141-11147163 CTTTGAATAAAAAATAGGCTGGG - Intronic
1020935973 7:14463962-14463984 CTGAGAATAAAAATAAGATTGGG + Intronic
1020945806 7:14604374-14604396 TTTTGAAAAAAAATAAAGTTGGG + Intronic
1021163752 7:17308015-17308037 CTAAGAAGAAAAATAAAGCAAGG - Intronic
1021184447 7:17547022-17547044 TTCTGATAAAAAATAAAGCTGGG - Intergenic
1021615814 7:22501423-22501445 CTGTGAATAAAAAACAATCATGG - Intronic
1022448024 7:30485723-30485745 CTGTGAAGGAAAATAAATCTTGG - Intergenic
1022563908 7:31377563-31377585 TTGTCAATAAAAATAAAGTGGGG - Intergenic
1022646933 7:32240468-32240490 CTATGATAAAAAATAAAGCAGGG + Intronic
1023374514 7:39542679-39542701 CTATGGAGAAAAATAAAGCAGGG + Intergenic
1024483291 7:49887892-49887914 CTGTGAATAAATACAACGCAAGG - Intronic
1025191976 7:56902684-56902706 GTGTCCATAAAAATATAGCTTGG + Intergenic
1025679976 7:63674247-63674269 GTGTCCATAAAAATATAGCTTGG - Intergenic
1026010769 7:66634222-66634244 CTATCTATAAAAATAAAGATAGG + Intronic
1027415615 7:77970804-77970826 CTGTGAAAAAAAAACAAACTTGG - Intergenic
1027601872 7:80249285-80249307 CATTGAATAAAGATAAAGATGGG - Intergenic
1027908422 7:84215567-84215589 CTGTGGGTTAAAATAGAGCTAGG - Intronic
1027955079 7:84867162-84867184 CTCTGAAGAAAAATAGAGCAAGG - Intergenic
1028976046 7:96915417-96915439 AAGTAAATAAAAATAAAGCTCGG + Intergenic
1030302365 7:107987456-107987478 CTGCCAAGAAAAAAAAAGCTAGG + Intronic
1030420419 7:109301175-109301197 CTTACAATGAAAATAAAGCTTGG - Intergenic
1031217054 7:118908180-118908202 CTGTGAATAAAAATAATAAGAGG - Intergenic
1031479016 7:122256027-122256049 CTCTGGAGAAAAATAAAGCAAGG - Intergenic
1031624009 7:123971375-123971397 GTGTAAATAAAAATAAATTTTGG + Exonic
1031713148 7:125074640-125074662 TTATGAAGAAAAATAAAGCAGGG + Intergenic
1031815768 7:126433152-126433174 CTGAGAAGAAAAATAAATCAGGG - Intergenic
1031831728 7:126635519-126635541 CTGAGAATAAAATTAAAATTTGG + Intronic
1032486824 7:132294119-132294141 CTATGGATAAAAATAGAGCCAGG + Intronic
1033071012 7:138202378-138202400 CTGTTAAAAAAAAAAAAGGTGGG + Intergenic
1033449090 7:141447206-141447228 CTATGGAGAAAAATAAAGCTGGG + Intronic
1033937985 7:146612068-146612090 TTGTCAATTTAAATAAAGCTTGG - Intronic
1033952265 7:146799372-146799394 CTGTGTATACAAATAAAAATGGG - Intronic
1033986055 7:147227020-147227042 CTGTGAAAACAAATAAAGTAAGG + Intronic
1034211919 7:149371350-149371372 AAGGAAATAAAAATAAAGCTGGG - Intergenic
1036596927 8:10221711-10221733 CTGTTGATTAAAATAAAGCAGGG + Intronic
1037101982 8:15058032-15058054 CAGTGAATAAAAGTAAAACAAGG + Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038882461 8:31629337-31629359 CTGTGAATAAAATCAATGTTTGG + Intergenic
1039202817 8:35115644-35115666 CTATGCATAAAAATTATGCTAGG + Intergenic
1039533017 8:38281231-38281253 CTGTGAGTGAAAATAAAACCAGG - Intronic
1039576499 8:38628089-38628111 ATATGTAGAAAAATAAAGCTGGG + Intergenic
1039585205 8:38701426-38701448 ATGCAAATAAAAATAAAACTTGG + Intergenic
1039595906 8:38789570-38789592 CTGTGGAGAAAAATAAAGCAGGG + Intronic
1039673603 8:39633827-39633849 CTGTAAAAAAAAAAAAAGGTGGG + Intronic
1040434805 8:47380023-47380045 CCTTGAATAAAAATAAAGCTTGG + Intronic
1040718733 8:50291298-50291320 CTGTGAAGAAAAACAAAACAGGG + Intronic
1041267469 8:56078859-56078881 CTGTGGGTAAAAATAATGCCCGG + Intergenic
1041955288 8:63552654-63552676 CTTAGAATAAAAATAAATCTGGG + Intergenic
1042892294 8:73626133-73626155 CTAGGAAGAAAAATAAAGCATGG + Intronic
1044062417 8:87654349-87654371 CAATGGAGAAAAATAAAGCTGGG + Intergenic
1044141599 8:88660508-88660530 CTGGGAATAAGAGTATAGCTAGG + Intergenic
1044443843 8:92250642-92250664 CTGTTGAGAAAAATAAAGCAAGG + Intergenic
1045098470 8:98822686-98822708 ATGTGAATAAAGGTAAAGCTGGG + Intronic
1045430098 8:102105710-102105732 CAGTGAATCAAAGTACAGCTGGG - Intronic
1046384663 8:113493881-113493903 CTTTGAATGAAAAAAAAGCCTGG + Intergenic
1047106520 8:121737031-121737053 CTGTGAAGCACAATAAAGCTAGG + Intergenic
1047824217 8:128555520-128555542 CTGTGAAGGAAAATGAAGCCAGG - Intergenic
1047981968 8:130192658-130192680 CTTTGAAGAAAAATAAGGCAAGG - Intronic
1048797143 8:138161163-138161185 CTCTGAATAGAATTCAAGCTTGG - Intronic
1049846103 8:144802565-144802587 CTATGGAGAAAAATAAAGCAAGG + Intronic
1050039207 9:1471096-1471118 CTGTGTATATAAATGGAGCTGGG + Intergenic
1050466399 9:5928772-5928794 CTGTGAAGAAAAATAAAGCAAGG - Intronic
1050634919 9:7602159-7602181 CTATGGAGAAAAATAAAGCAAGG - Intergenic
1050727311 9:8665693-8665715 CTGTGAAGAGAAATAAAAGTGGG - Intronic
1051326186 9:15972024-15972046 CTGTGATAACAAATAAAACTTGG - Exonic
1051395351 9:16614538-16614560 CTCTAAATAAAAAGAAAGCAAGG + Intronic
1051470625 9:17436686-17436708 CTGTAAATAAATATAAACCAAGG - Intronic
1051691097 9:19713072-19713094 CTGGGAAGAAAAATAAAACAGGG - Intronic
1052068972 9:24058115-24058137 CTATAAATAAAAATAAGGCAGGG + Intergenic
1052095096 9:24374042-24374064 CTATGAAAGAAAATAAATCTTGG - Intergenic
1052404430 9:28041436-28041458 CCTTGAATAAAAATAATGCTAGG + Intronic
1053210719 9:36225332-36225354 TTGTCATTAAAAATAAATCTAGG + Intronic
1054778919 9:69148529-69148551 CTGAGAATACAAAAATAGCTAGG - Intronic
1055225889 9:73994777-73994799 CTGCAAATAAAAATCAAGATTGG - Intergenic
1055417963 9:76104798-76104820 CATTGAAAAAAAATAAAACTTGG + Intronic
1056136721 9:83636495-83636517 CTGTGAAGAGAAAAAAAGTTGGG - Intronic
1056806157 9:89730605-89730627 CTGCAAATAAAAATATACCTGGG - Intergenic
1056868563 9:90254577-90254599 CTTTGAGTAAAAATGAGGCTAGG + Intergenic
1057934458 9:99225275-99225297 CTATGAAGATAAATAAAGCTGGG + Intronic
1058596273 9:106618918-106618940 CTGTGAAGACAATTAAAGCAGGG - Intergenic
1058630355 9:106980046-106980068 CACTGAATAAAATTAAAGATTGG - Intronic
1058649024 9:107157685-107157707 CTGTGAAGAAAAATAAAGTTGGG - Intergenic
1058748544 9:108016023-108016045 CTGTGGATAAAAATAAAGCAAGG - Intergenic
1058805691 9:108589220-108589242 CTTAGAAGAAAAATAAAACTTGG - Intergenic
1059490747 9:114665585-114665607 CTGTTAATAAAGATATACCTTGG + Intergenic
1059576011 9:115489343-115489365 CAGTTAAGAAAACTAAAGCTTGG + Intergenic
1060013315 9:120063811-120063833 TTGTTAACAAAAATAAAGCAGGG - Intergenic
1060091111 9:120744411-120744433 CTGTGAAGAAAAACAAAGTATGG + Intergenic
1060604996 9:124905826-124905848 ATATGATTAAAAATAAAGTTCGG + Intronic
1061400725 9:130366907-130366929 CTATGGAGAAAAATAAAGCTAGG + Intronic
1061940671 9:133882191-133882213 CTGTCAATAAACAGAAAGCAAGG + Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186842367 X:13496704-13496726 CTTTGTGTAAAAATAAATCTTGG - Intergenic
1188993093 X:36848311-36848333 CTGATTGTAAAAATAAAGCTTGG - Intergenic
1189244636 X:39554092-39554114 CTGTGGAGAAAATTAAAGCAGGG + Intergenic
1189655625 X:43241837-43241859 ATTTGAAAAAAAATAAAACTGGG - Intergenic
1189899903 X:45695854-45695876 CTATGGAAAAAAATAAAACTGGG + Intergenic
1190469858 X:50767880-50767902 TTGTGATTAAAAAGAAATCTGGG + Intronic
1191215072 X:57925226-57925248 CTGTGAATTAAAATACAGTGCGG - Intergenic
1191885291 X:65881793-65881815 CTATGAAGAAAAATAAAGCAAGG - Intergenic
1192210208 X:69123136-69123158 CTGTGTGTACAAATACAGCTTGG - Intergenic
1193324445 X:80163099-80163121 CAGTCAATAAAAATAAAAATAGG + Intergenic
1194157256 X:90405736-90405758 CAGTAAATAAAAGGAAAGCTTGG + Intergenic
1194359187 X:92927700-92927722 TGGTGAAGAAAAATAAAGCAGGG + Intergenic
1194371675 X:93080996-93081018 CTATGAATAAAAATAAAATAAGG - Intergenic
1194685726 X:96911693-96911715 CAATGAAGAAAAATAAACCTTGG - Intronic
1194937785 X:99971518-99971540 CTATAGAGAAAAATAAAGCTTGG - Intergenic
1195449518 X:104995121-104995143 CTATGAAGAAGAATAAAGCATGG - Intronic
1196396381 X:115266760-115266782 CTGTGGATTAAAATAAAATTTGG - Intergenic
1196824590 X:119731290-119731312 CTCTGGATAAAAACAAAGCAGGG + Intergenic
1196841704 X:119865248-119865270 CTATGAAAAACAATAAAGCAAGG - Intergenic
1197005929 X:121498107-121498129 ATGTGATTAAAAAAAAAACTAGG - Intergenic
1197645232 X:129010098-129010120 CTGTAAACAAGAATAAAGGTGGG - Intergenic
1197698636 X:129578511-129578533 CTCTGACTAAAAATAAGGGTAGG - Intronic
1198234512 X:134724700-134724722 CTTTTAATAAAAACAAAACTCGG + Intronic
1198396068 X:136220452-136220474 ATGTGAACAAAAGTAAAGTTTGG + Intronic
1198663262 X:138994691-138994713 CTCTGATTAAATATAAAGCATGG - Intronic
1198944971 X:142001065-142001087 CAATGAAGAAAAATAAAGCAGGG - Intergenic
1199724958 X:150570488-150570510 ATGTGAGTAAAAATGAGGCTGGG - Intronic
1199943934 X:152650776-152650798 ATGTGAAAAAAAATCAAGGTTGG + Intronic
1200503588 Y:3982718-3982740 CAGTAAATAAAAGGAAAGCTTGG + Intergenic
1201351525 Y:13048043-13048065 CTAAGAATAAAAAAAATGCTAGG + Intergenic
1201487471 Y:14508294-14508316 CTCTCAATGAAAAGAAAGCTTGG - Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic
1201631158 Y:16073230-16073252 CTTTCAATGAAAAGAAAGCTTGG - Intergenic