ID: 1015989940

View in Genome Browser
Species Human (GRCh38)
Location 6:138929273-138929295
Sequence CAGGTGTTTTAGGGGAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 415}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015989928_1015989940 24 Left 1015989928 6:138929226-138929248 CCAAATGGAGCTCTCCAGGGCAC 0: 1
1: 0
2: 1
3: 12
4: 120
Right 1015989940 6:138929273-138929295 CAGGTGTTTTAGGGGAGGCAGGG 0: 1
1: 0
2: 1
3: 22
4: 415
1015989929_1015989940 10 Left 1015989929 6:138929240-138929262 CCAGGGCACTAAAATTTAACAGA 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1015989940 6:138929273-138929295 CAGGTGTTTTAGGGGAGGCAGGG 0: 1
1: 0
2: 1
3: 22
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015989940 Original CRISPR CAGGTGTTTTAGGGGAGGCA GGG Intronic
900274720 1:1817103-1817125 CAGGGGTGTTAGGGGAGAGAGGG - Intronic
901617722 1:10555090-10555112 CAGGTGGTTTTGGGAAGGGATGG - Intronic
903238171 1:21964227-21964249 CAGGAGTTTGTGGGGAGCCAGGG - Intergenic
903547715 1:24137062-24137084 CAGGTGTTTGCGGGGTGGGATGG - Intronic
904312728 1:29639811-29639833 CAGCTGTGTGAGGTGAGGCAGGG - Intergenic
904605694 1:31696473-31696495 CAGGTTCTTTAGAGGTGGCATGG - Intronic
906300858 1:44680651-44680673 CAAGTGTTTAAGAGGAGTCAGGG + Intronic
906567205 1:46809658-46809680 CTGGAGTTTGTGGGGAGGCATGG - Intronic
908844303 1:68309254-68309276 CAGTTCTTTCAGGGGAGGAAGGG + Intergenic
908976879 1:69909444-69909466 GAGGTCTTTTAGGGCAGGCCTGG + Intronic
909587908 1:77311989-77312011 CAGGAGCTGTAGGGGAGGAAGGG - Intronic
911074309 1:93857686-93857708 GAGCTGTTTTAGGGCAGGCCTGG - Intergenic
911614218 1:99990735-99990757 CATGTGAATTTGGGGAGGCAGGG - Intronic
911809591 1:102258372-102258394 CAGGTGTCTGAGGGGAGGGAGGG + Intergenic
912062304 1:105687571-105687593 CAGGTGCAGTAGGGGAGGCGTGG - Intergenic
912865564 1:113253107-113253129 CAGATGTTTTAGGGGCAGGAAGG + Intergenic
912930080 1:113950201-113950223 CAGGGGGTTGAGGGAAGGCAAGG - Intronic
913027045 1:114854304-114854326 CGGCTATTTTAGGAGAGGCAGGG + Intergenic
913467220 1:119155446-119155468 GAGCTGTTTTAGGGCAGGCCTGG + Intergenic
913931120 1:124966014-124966036 GAGCTGTTTTAGGGCAGGCCTGG + Intergenic
914262861 1:146013862-146013884 CAGGGTTTTTAGTGGAGACAGGG + Intergenic
915119017 1:153617080-153617102 CAGCTGGGTTAGGGAAGGCATGG - Intergenic
916020221 1:160785012-160785034 GAGCTCTTTTAGGGGAGGCCTGG - Intergenic
916374718 1:164140164-164140186 CAGGGGTTAGAGGGAAGGCAGGG + Intergenic
916802930 1:168231409-168231431 AAGTTGTATTAGGGAAGGCAAGG - Intronic
917539796 1:175901508-175901530 GAGGGGTGTTAGGGGAGGTAGGG + Intergenic
917893851 1:179466840-179466862 CAGGTCATTTAGTGCAGGCACGG + Intronic
920441974 1:205986786-205986808 CAGTTTATTTAGGGGAGCCAAGG + Intronic
920573542 1:207037109-207037131 GAGCTGTTTTAGGGGAGTCAAGG - Intronic
920590055 1:207208707-207208729 CAGCTCTTTTAGGGCAGGCCTGG - Intergenic
920632020 1:207661819-207661841 AAGCTGTTTTAGGGCAGGCCTGG + Intronic
920667813 1:207978542-207978564 CAGGCTTTTTAGGAGAAGCATGG + Intergenic
922084580 1:222333843-222333865 GTGGTGTTTTAGGGTAGGAAGGG - Intergenic
922578806 1:226681819-226681841 CATTTGTTTTGGAGGAGGCAGGG - Intronic
923187574 1:231588877-231588899 CAGATGTTGTAGGGGACACAGGG - Intronic
924063604 1:240201853-240201875 CAGGTGTTTTATGGGAAGTTTGG + Intronic
924158818 1:241208967-241208989 CAGGTGCTCCAGTGGAGGCAAGG + Intronic
924204096 1:241693396-241693418 CAGGGCTTTGAGGGGAGGGAGGG + Intronic
1062762640 10:37291-37313 GAGCTGTTTTAGGGCAGGCCTGG - Intergenic
1062941356 10:1423487-1423509 CAAAGGTTCTAGGGGAGGCAGGG + Intronic
1065406445 10:25371342-25371364 GAGGTCTTTTAGGGCAGGCCTGG + Intronic
1065937178 10:30531182-30531204 GAGGTGTTCTCAGGGAGGCAGGG - Intergenic
1066533523 10:36365937-36365959 CTTGTGTTTTGGGGAAGGCAGGG + Intergenic
1068159006 10:53239611-53239633 GAGGTGTTTTATGGGAGACAGGG - Intergenic
1069110467 10:64440545-64440567 GAGGTCTTTTAGGGCAGGCCTGG + Intergenic
1069337739 10:67372944-67372966 GAGGTCTTTTAGGGCAGGCCTGG - Intronic
1069822494 10:71236356-71236378 CACATGTTTTAGGTGAGGCAGGG - Intronic
1070412845 10:76159863-76159885 CAGGTGTTATGGGGGAGGAAAGG + Intronic
1071127053 10:82348241-82348263 CAGCTCTTTTAGGGCAGGCCTGG + Intronic
1071226483 10:83535877-83535899 AATGTGTTTTAGGCCAGGCACGG - Intergenic
1072405613 10:95149330-95149352 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
1072855250 10:98939053-98939075 GAGCTGTTTTAGGGCAGGCCTGG - Intronic
1072859250 10:98985459-98985481 GAGCTGTTTTAGGGCAGGCCTGG - Intronic
1072874250 10:99154570-99154592 GAGCTGTTTTAGGGCAGGCCTGG - Intronic
1073033698 10:100548274-100548296 CAGGTGTTTGGAGCGAGGCAGGG + Exonic
1073422877 10:103438617-103438639 CAGGTGTATTGGGGGTGGCATGG + Intronic
1074293130 10:112156485-112156507 AAGGCCATTTAGGGGAGGCAGGG - Intronic
1075068244 10:119303952-119303974 CTGGCGCTTTAGGGTAGGCAAGG - Intronic
1075490960 10:122868751-122868773 GAGGTCTTTTAGGGCAGGCCTGG - Intronic
1077167889 11:1152001-1152023 CAGGTGCCTTAGGGTAGGCGTGG + Intergenic
1077451148 11:2646516-2646538 CTGATTTTTTGGGGGAGGCAGGG + Intronic
1077532003 11:3101762-3101784 CAGGTTTTTTGGGGGAAGCTGGG - Intronic
1078435976 11:11326332-11326354 AAGATGTTTTAGGCCAGGCACGG - Intronic
1078688836 11:13559134-13559156 GAGCTGTTTTAGGGCAGGCCTGG + Intergenic
1078711624 11:13798002-13798024 CAGCTCTTTTAGGGCAGGCCTGG + Intergenic
1080363682 11:31545952-31545974 CAGCTCTTTTAGGGCAGGCCTGG - Intronic
1082134479 11:48532082-48532104 GAGGTGTTTTAGGGCAGGCCTGG + Intergenic
1083522862 11:63332251-63332273 CAGTTCTTGTAGGGCAGGCATGG + Intronic
1086205842 11:84257388-84257410 CAGGGGATTTAGGTGTGGCAGGG - Intronic
1086661801 11:89428187-89428209 GAGCTCTTTTAGGGGAGGCCTGG - Intronic
1088245532 11:107814491-107814513 CAGGAGTTTGTGGGGAGGGAGGG + Intronic
1089493881 11:118899075-118899097 CAGGTGCTGCTGGGGAGGCATGG + Exonic
1091441895 12:517471-517493 CAGGTGTCTTGTGGGAGGCGAGG + Intronic
1091832515 12:3559997-3560019 CAGGTGTGTGAAGGGAGGAATGG - Intronic
1092680002 12:10968668-10968690 CAGCTGCTTTAGGGCTGGCAGGG + Intronic
1093332269 12:17857372-17857394 GAGCTCTTTTAGGGGAGGCCTGG - Intergenic
1093715479 12:22376893-22376915 GAGGTGTGGAAGGGGAGGCACGG + Intronic
1093946958 12:25120267-25120289 CAGGTGTGTTAGGGGAGAGAGGG + Intronic
1094792668 12:33932387-33932409 GAGCTCTTTTAGGGGAGGCCTGG - Intergenic
1095638108 12:44455514-44455536 CAGGGGGATTAGGGGCGGCACGG - Intergenic
1095661637 12:44743269-44743291 GAGGTCTTTTAGGGCAGGCCTGG - Intronic
1096670894 12:53197730-53197752 CTGGTGAGTTAGGGGAGGCGGGG - Exonic
1097008870 12:55938484-55938506 GGGGTGTTTTAGGGGGGCCAGGG - Intronic
1097734422 12:63166423-63166445 GAGCTGTTTTAGGGCAGGCCTGG + Intergenic
1098925985 12:76349724-76349746 CCTGTGTTTTAGGCCAGGCAAGG - Intergenic
1102448630 12:113023634-113023656 TAGGGGTTTTAGGCCAGGCACGG - Intergenic
1104000613 12:124857562-124857584 CTGGTGTTGAAGGGGTGGCAAGG + Intronic
1104366194 12:128179801-128179823 CAGGTGTTTAAGGAGAGACCTGG - Intergenic
1105892195 13:24689771-24689793 CAGGGGTTTTTGGGGAAGAAGGG - Intronic
1106107611 13:26747060-26747082 CAGGTGTTTAAGCAGAAGCAAGG + Intergenic
1106939282 13:34759378-34759400 CAGGGGTTAGAGGGGAGGGAGGG - Intergenic
1107304598 13:39005024-39005046 GAGCTGTTTTAGGGCAGGCTTGG + Intergenic
1107760623 13:43674567-43674589 CAGGGGTTGTGGGGGAGGGAAGG + Intronic
1108388320 13:49922599-49922621 CAAGTGTTTAAAGAGAGGCATGG - Intronic
1108640900 13:52381412-52381434 CAGGTGTTTTAGGGGACCCATGG - Intronic
1109619251 13:64880123-64880145 CAGGGGGTTTGGGGGAGGCGGGG - Intergenic
1111436467 13:88216249-88216271 CTGGTGTTTTAGAGGGAGCATGG + Intergenic
1113371242 13:109727492-109727514 CAGGTGGTTTATGTGAGGCCTGG + Intergenic
1113500338 13:110768708-110768730 CAGGTGTTACAGGGGAGAGAGGG + Intergenic
1115315207 14:32017874-32017896 CAAATGTCTTAGGGGAGGAAAGG - Intronic
1115432214 14:33332450-33332472 CATGAGTTTTAGGGGAAGAAAGG + Intronic
1116019670 14:39445013-39445035 CAGTTATTTTAGGCCAGGCATGG + Intergenic
1117259187 14:54012900-54012922 CAGGCGTTAGAGGGGAGGGAGGG - Intergenic
1117369843 14:55067359-55067381 CAGGCGTTTTAGTGGAGAAATGG + Exonic
1117479490 14:56128897-56128919 CAGGTTTTTGTGGGGAGGGAGGG + Intronic
1117597841 14:57342263-57342285 CAGCTCTTTTAGGGCAGGCCTGG + Intergenic
1118908692 14:70043275-70043297 CAGGTGGCTTGGGGGAGGTAGGG + Intergenic
1119289294 14:73482059-73482081 CAGGTATTTGTGGGGAGGAAAGG + Intronic
1119842601 14:77804579-77804601 GAGGGGGTTCAGGGGAGGCAGGG + Intronic
1120400310 14:84022847-84022869 CAGGTTTTTCAGGGTAGGCAGGG + Intergenic
1122616615 14:103022268-103022290 CAGCAGTTTTGAGGGAGGCAGGG + Intronic
1123774749 15:23566982-23567004 CAGGTATTTTGCGGAAGGCAGGG + Exonic
1125013678 15:34908537-34908559 AAAGTGTTTTATGGGAGGCCTGG - Intronic
1126167997 15:45669823-45669845 CATGTGGTCTAAGGGAGGCAGGG - Intronic
1126670345 15:51110385-51110407 CAGGTGGTTGGGTGGAGGCATGG + Intergenic
1127463436 15:59221298-59221320 CATGTGTCTTAGGCCAGGCATGG - Intronic
1128565860 15:68700092-68700114 CAGGTGCTTTGAAGGAGGCAGGG - Intronic
1129940202 15:79489961-79489983 GAGCTGTTTTAGGGCAGGCCTGG + Intergenic
1130806724 15:87331569-87331591 GAGGTCTTTTAGGGCAGGCCTGG + Intergenic
1130818444 15:87465556-87465578 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
1130822706 15:87511720-87511742 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
1131745193 15:95439860-95439882 CAAGTGGTTCAGGAGAGGCAAGG + Intergenic
1132976821 16:2715290-2715312 CAGGTGGGTGAGGGGAGGAAGGG + Intronic
1132989608 16:2786016-2786038 CAGGTGTTGGTGGGGAGACACGG + Intronic
1132999514 16:2841907-2841929 GAGGTGGTTTAGAGGAGGCTGGG + Intergenic
1133468852 16:6054239-6054261 TATGTTTTTTTGGGGAGGCAGGG + Intronic
1134059411 16:11190082-11190104 CAGGAGTTTGAGATGAGGCAGGG - Intergenic
1134531019 16:14983952-14983974 CAGGAGTTTGAGGGCAGCCAGGG + Intronic
1139381766 16:66536914-66536936 CAGGTGCTTAAGGGGAAGCCGGG + Intronic
1139865331 16:70057077-70057099 CAGGAGTTTGAGGGCAGCCAGGG - Intergenic
1141661061 16:85441798-85441820 CAGGGGTTAGAGGGGAGGCAGGG - Intergenic
1142127320 16:88416702-88416724 TGGTTGTTTTAGGGGAGGGATGG + Intergenic
1142386516 16:89768828-89768850 CAGGTGGCTTGGGGGAGACAGGG - Intronic
1144584823 17:16481851-16481873 CAGGTGCTCCTGGGGAGGCAGGG - Intronic
1144792287 17:17867190-17867212 CAGGTGTGTGAGGAGAGGCTGGG - Intronic
1145855294 17:28150648-28150670 CAAGTGTTTTAGTGGGGGCGGGG - Intronic
1147714179 17:42493054-42493076 CAGGTGTTTTAGGGCTGTGAGGG - Intronic
1148850971 17:50555186-50555208 CCGGTGTGTCAGGGGAGGGAGGG - Intronic
1149516552 17:57285221-57285243 CCGGAGTTTCAGGGGAGGGAGGG + Intronic
1149641763 17:58207299-58207321 CAGGTGTTTTAGCTGAGTCTAGG - Intronic
1149711837 17:58750481-58750503 CAGGGGTTCTGGGGGAGGGAGGG - Intergenic
1150358099 17:64505709-64505731 GAGGTGTTTTTGGGGTGGCCGGG - Intronic
1151585360 17:75005170-75005192 CAGGCATTTTATGGGAGGGAGGG - Exonic
1152381700 17:79945521-79945543 GAGCTGTTTTAGGGCAGGAAGGG + Intronic
1152732669 17:81980269-81980291 CAGGTCTTCAAGGGCAGGCATGG - Intronic
1152810569 17:82379971-82379993 CATGTGTGTTCTGGGAGGCAGGG - Intergenic
1152955550 18:37622-37644 GAGCTGTTTTAGGGCAGGCCTGG - Intergenic
1155917529 18:31571152-31571174 CAGGGGTTGCAGGGGAGGTAGGG + Intergenic
1155921466 18:31607530-31607552 CATGTGAAATAGGGGAGGCATGG + Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1157572756 18:48723834-48723856 CATGTGTTTTGGGGAAGCCAAGG + Intronic
1158149178 18:54347903-54347925 CAGGTGTTGTAGGAGAGACCTGG + Intronic
1160254039 18:77232318-77232340 CAGCCATTTTAGGGGAGGGACGG + Intergenic
1161583135 19:5091561-5091583 CTGGGGTTTTAGGAGAGGCCTGG - Intronic
1162459941 19:10808878-10808900 CAGGGATGTGAGGGGAGGCAGGG - Intronic
1162542236 19:11304201-11304223 CAGGTGGTTGAGGCCAGGCAGGG + Intronic
1163018172 19:14469542-14469564 CAGATGCTGTAGGGGAGGCAGGG - Intronic
1163078844 19:14921087-14921109 CTGGAGTTTTAGGCCAGGCAGGG + Intergenic
1163450266 19:17373122-17373144 CAGGTCTGAGAGGGGAGGCAGGG + Intronic
1165384040 19:35500115-35500137 CAGGTGTTTTAGGAAAGGTCTGG - Intronic
1165757623 19:38303555-38303577 TAGGTGTTTTAGGCCAGTCATGG - Intronic
1166433605 19:42748119-42748141 GAGGTCTTTTAGGGCAGGCCTGG + Intronic
1166436708 19:42773260-42773282 GAGGTCTTTTAGGGCAGGCCTGG + Intronic
1166440522 19:42810373-42810395 GAGGTCTTTTAGGGCAGGCCTGG - Intronic
1166613787 19:44224941-44224963 GAGGTCTTTTAGGGCAGGCCTGG + Intronic
1166775322 19:45308590-45308612 CAGATGTTTTGGGGGAGGGCTGG - Intronic
1167144293 19:47672648-47672670 GGGGTGTTTGAGGGGAGGGAAGG + Intronic
1167153257 19:47722382-47722404 CCGTTGTTTTGGGGGAGGAAGGG - Intronic
1167502510 19:49855927-49855949 CAGGTGCTGGAGAGGAGGCAGGG + Intronic
1168510429 19:56969172-56969194 GAGGTGTTTTAGGCAAGGGAGGG - Intergenic
1168632576 19:57968922-57968944 GGGGTGATTTAGGGCAGGCAGGG - Intronic
925269177 2:2590202-2590224 CAGGAGTTTGGAGGGAGGCAAGG - Intergenic
925543660 2:4994301-4994323 CAGGTGTTTTGAGGGAGGAAAGG + Intergenic
926054295 2:9765372-9765394 CAGGAGTTTTAGCAGAGGCTGGG + Intergenic
926294846 2:11561653-11561675 CAGGTGCTGTAGGCCAGGCACGG - Intronic
926585143 2:14677525-14677547 CAGGTGTTTTATGGCTGGTAAGG + Intergenic
927334583 2:21907492-21907514 GAGCTGTTTTAGGGCAGGCCTGG + Intergenic
928016811 2:27664857-27664879 CAGGAGTTTGAGAGGAGGCTGGG + Intronic
928370386 2:30736198-30736220 CAGGTGTTGCAGTGGATGCAGGG + Intronic
928758965 2:34559488-34559510 GAGCTCTTTTAGGGCAGGCATGG + Intergenic
929713400 2:44287412-44287434 CATGTGTTTCAGGGATGGCATGG + Intronic
930739105 2:54811149-54811171 GAGGGGTGTTAGGAGAGGCAAGG - Intronic
931210642 2:60190856-60190878 CAGCTCTTTTAGGGCAGGCCTGG - Intergenic
933590469 2:84226700-84226722 GAGCTCTTTTAGGGCAGGCATGG - Intergenic
934889640 2:98056013-98056035 CCTCTGTTTTAGGGAAGGCATGG - Intergenic
934919907 2:98334501-98334523 CATGTATTTTAGAGGAGACAAGG - Intronic
936987696 2:118327251-118327273 AAGGTGAGTTAGGGGAGGCGAGG + Intergenic
937134605 2:119542129-119542151 CAGGAGTTTGAGAGGAGGCAGGG - Intergenic
938020064 2:127899013-127899035 CAGTAGTTTTAGGGGTGTCAAGG - Intergenic
938167318 2:129042317-129042339 GAGCTCTTTTAGGGCAGGCATGG + Intergenic
938809843 2:134843131-134843153 GAGGTGTGTTGGGGGAGGAATGG - Intronic
939642973 2:144663171-144663193 AAGGTGTTGTGGGGGAGACAAGG + Intergenic
941313581 2:163964887-163964909 CAGGCGTTTTAGGGGGAACACGG + Intergenic
941534548 2:166706904-166706926 GAGGTCTTTTAGGGCAGGCCTGG + Intergenic
941593876 2:167452025-167452047 CCGGTGCTGTTGGGGAGGCATGG - Intergenic
941649989 2:168082196-168082218 CAGATGATGTAGAGGAGGCAGGG - Intronic
942164391 2:173228061-173228083 CAAGTGTTTCCGAGGAGGCAAGG + Intronic
943840127 2:192569921-192569943 CAGGGGTTATGGGGGAGGGAGGG - Intergenic
945664502 2:212724108-212724130 CAGGTGATTTTGGGGAGGCCAGG - Intergenic
946651404 2:221895832-221895854 GGAGTGTTTTAGGGAAGGCAAGG - Intergenic
947403519 2:229751792-229751814 CAGGTATTTGAGGGAAAGCAAGG + Intergenic
948181822 2:235988331-235988353 AAGGAGTTTTAGGCCAGGCACGG - Intronic
948413033 2:237779269-237779291 CAGTTGTTTCAGAGGAGGAAGGG + Intronic
1168763066 20:362791-362813 GAGGAGTTTGTGGGGAGGCAGGG + Intergenic
1169041958 20:2502780-2502802 GAGGTCTTTTAGGGCAGGCCTGG - Intronic
1169080202 20:2793774-2793796 CAGGAGTTTGAGTGCAGGCACGG + Intergenic
1169167496 20:3436827-3436849 CAGATGTTCTAGGCCAGGCATGG + Intergenic
1170031501 20:11948854-11948876 AAGGTGTATTTGTGGAGGCAAGG - Intergenic
1170049592 20:12127874-12127896 GAGGTCTTTTAGGGCAGGCCTGG + Intergenic
1170097635 20:12664103-12664125 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
1170208134 20:13821648-13821670 GAGGTGTATTAGGGTGGGCAAGG + Intergenic
1170676691 20:18488472-18488494 CAGGTGTTTGAGGCCAGCCAGGG - Exonic
1170931192 20:20770640-20770662 CAGGTGGTTCAGGCCAGGCATGG - Intergenic
1171466510 20:25331773-25331795 GAGGTCTTTTAGGGCAGGCCTGG - Intronic
1173301220 20:41805446-41805468 GAGCTGTTTTAGGGCAGGCCTGG + Intergenic
1173453724 20:43188174-43188196 TAGGTGTGCTAGGGGAGGGAGGG - Intronic
1174183562 20:48689988-48690010 CAGGTGTTGCAGGGGAGACCAGG + Intronic
1174449374 20:50610048-50610070 CAGGGGTGGCAGGGGAGGCAGGG - Intronic
1174682397 20:52421217-52421239 AGGCTGTTATAGGGGAGGCAGGG + Intergenic
1175075046 20:56365042-56365064 GAGGTGCTTTAGGGCAGGCACGG - Intronic
1175652437 20:60737224-60737246 CAAGTGTTGGAGGGGAGGCCTGG + Intergenic
1175764574 20:61583422-61583444 CAGATGTTTGAGGGGAGACGGGG + Intronic
1176020157 20:62958653-62958675 CAGAGGTTCTAGGGGAGCCATGG - Intronic
1177935570 21:27341084-27341106 CAGGTATTTAAGGGGAGGAAGGG + Intergenic
1178031365 21:28530090-28530112 CAGGGGTTATAGGAGAGGGAGGG - Intergenic
1179804549 21:43828956-43828978 CAGGTGTTTTGGGGGTGGGGGGG - Intergenic
1180044304 21:45296307-45296329 CGGGAGTTTTAAGGGATGCACGG + Intergenic
1181023830 22:20116766-20116788 CAGGTGCGATAGGGGAGGAAAGG - Intronic
1181302561 22:21891736-21891758 TAGTTGTTTTAGTAGAGGCAGGG - Intergenic
1181960712 22:26619816-26619838 CTGGGGCTTTAGGGGGGGCACGG - Intergenic
950479238 3:13234489-13234511 CAGGTGTTTCAGGGAAGGGAGGG - Intergenic
950998238 3:17528045-17528067 TAGGTTTTTTAGGGGGGGCTGGG + Intronic
951761156 3:26148586-26148608 CAGTGCTTTTAGGGGAGACATGG + Intergenic
952280664 3:31920140-31920162 CTAGTGGTTTAGGGGAGGAAGGG + Intronic
952612502 3:35227765-35227787 CAGCTCTTTTAGGGCAGGCCTGG - Intergenic
952955743 3:38556203-38556225 TAGGTGGATTAGGGCAGGCATGG + Intronic
953192679 3:40702318-40702340 CAGGTGTTAGAGGGGAGGAAGGG - Intergenic
953555575 3:43944185-43944207 GAGGTCTTTTAGGGCAGGCCTGG + Intergenic
954575916 3:51676181-51676203 CAGGTGTGGAAGGGGGGGCAGGG - Intronic
954896368 3:53978584-53978606 CAGGGGCTTAAGGGGAGGGAGGG + Intergenic
955135646 3:56214960-56214982 GAGCTCTTTTAGGGCAGGCATGG - Intronic
955211672 3:56947095-56947117 GAGCTGTTTTAGGGCAGGCCTGG - Intronic
956319545 3:67981521-67981543 CAGGTGTTTTAGGCTGGGCGCGG + Intergenic
956984283 3:74679324-74679346 CAGGTGATTTATGGAAGGAAAGG - Intergenic
958949963 3:100405924-100405946 GAGGTGTATGAAGGGAGGCATGG - Intronic
959504882 3:107146048-107146070 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
959522476 3:107335671-107335693 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
959553966 3:107696371-107696393 GAGGTCTTTTAGGGCAGGCCTGG + Intronic
960146683 3:114211346-114211368 GTGGTCTTTTAGGGTAGGCAAGG + Intergenic
960775334 3:121244731-121244753 CAGGTTTTTTAGCAGAAGCATGG + Intronic
961617517 3:128194382-128194404 CAGATGCTTTTGGGGTGGCAGGG + Intronic
963070298 3:141299712-141299734 CAGCTCTTTTAGGGCAGGCCTGG + Intergenic
963578983 3:147100090-147100112 TAGGTGTTTTAGTGGAGACAGGG - Intergenic
964843043 3:161015208-161015230 CAGCTGGTTTAGGGGAAGGAAGG - Intronic
965650633 3:170929103-170929125 GAGCTGTTTTAGGGCAGGCCTGG + Intergenic
967807666 3:193729873-193729895 CAGTGATTGTAGGGGAGGCAGGG + Intergenic
968276487 3:197444306-197444328 CAGGTGTTGTGGGGGGGGTACGG + Intergenic
968903310 4:3440951-3440973 GAGGGGTTTTAGGGGATACAGGG + Intergenic
968917974 4:3505525-3505547 CAGGTGTGGTTGGGGATGCAGGG - Intergenic
969521774 4:7682216-7682238 CGGGTGTTCTAGGGTAAGCATGG + Intronic
969978017 4:11124429-11124451 CAGATGGTTTTGGTGAGGCAGGG - Intergenic
970085021 4:12336377-12336399 GAGCTGTTTTAGGGCAGGCCTGG - Intergenic
971516337 4:27491457-27491479 CAGGTGTTTTTGGGAAGCAATGG + Intergenic
971896567 4:32604756-32604778 CAGGTGTTGGAGGAGAGGCCTGG - Intergenic
972364864 4:38364922-38364944 CATGGGTTTTAGGGTAGGCTTGG - Intergenic
973066707 4:45804435-45804457 GAGCTGTTTTAGGGCAGGCCTGG - Intergenic
973164486 4:47059719-47059741 CATGTTTTAGAGGGGAGGCATGG - Intronic
974114734 4:57566494-57566516 GAGCTCTTTTAGGGCAGGCATGG + Intergenic
974171478 4:58271540-58271562 CAGGTGTTGTAGGAGAGACCTGG + Intergenic
979071011 4:116206352-116206374 CAGATGTTTTTGCAGAGGCAAGG + Intergenic
979337652 4:119481996-119482018 CAGGGGTTAAAGGGGAGGAAGGG + Intergenic
979948640 4:126865031-126865053 CAGCTCTTTTAGGGCAGGCCTGG + Intergenic
980495693 4:133585937-133585959 AAGGTGTTTCAGGGGGTGCATGG - Intergenic
981096398 4:140786840-140786862 GAGCTGTTTTAGGGCAGGCCTGG + Intergenic
983073495 4:163297226-163297248 CAAGTGTTTCAGGCCAGGCATGG + Intergenic
983330661 4:166323785-166323807 CAAGTGTGTGAGGGGAGGGAAGG + Intergenic
983400959 4:167264987-167265009 CAGGGTTTTTAGAGGAGGGAAGG - Intergenic
983505236 4:168546388-168546410 CTGGTAATTTGGGGGAGGCAAGG - Intronic
983799167 4:171904962-171904984 GAGCTGTTTTAGGGCAGGCCTGG - Intronic
984295419 4:177848080-177848102 GAGCTGTTTTAGGGCAGGCCTGG + Intronic
984742540 4:183179647-183179669 CAGGTCATTTGGGGGAGGAATGG + Intronic
986674507 5:10171249-10171271 CAGGTGTCTTGGGTGAGGGAAGG + Intergenic
990142294 5:52719712-52719734 GAGCTGTTTTAGGGCAGGCCTGG - Intergenic
991160019 5:63488351-63488373 GAGCTGTTTTAGGGCAGGCCTGG + Intergenic
991209643 5:64089136-64089158 GAGCTGTTTTAGGGCAGGCCTGG - Intergenic
991210670 5:64100987-64101009 GAGCTGTTTTAGGGCAGGCCTGG - Intergenic
991213370 5:64133271-64133293 GAGCTGTTTTAGGGCAGGCCTGG + Intergenic
992978624 5:82142343-82142365 AAGGTTTTCTAGTGGAGGCAGGG + Intronic
994753348 5:103764887-103764909 CAGCTGTAGTGGGGGAGGCATGG - Intergenic
995103128 5:108340258-108340280 AACGTGTTTTAGGCCAGGCATGG + Intronic
995676933 5:114672700-114672722 GAGCTGTTTTAGGGCAGGCCTGG - Intergenic
995722688 5:115152832-115152854 CAGTTCTTTTAGAGGAGGCTTGG - Intronic
996002897 5:118384923-118384945 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
996074040 5:119168760-119168782 CAGGTGTTTGAGATGAGCCAGGG - Intronic
996788785 5:127270050-127270072 CAGCTCTTTTAGGGCAGGCCTGG - Intergenic
997345144 5:133184895-133184917 GAGCTCTTTTAGGGGAGGCCTGG + Intergenic
997578467 5:135002136-135002158 GAGCTCTTTTAGGGGAGGCCTGG + Intronic
998121837 5:139584821-139584843 AAGGTGTTTTGGGCTAGGCACGG - Intronic
998517239 5:142767807-142767829 CAAGTGATTCAGGGCAGGCAAGG + Intergenic
999159195 5:149481274-149481296 CAGGTGTTTGAGATCAGGCAGGG + Intergenic
999947058 5:156609218-156609240 GAGCTGTTTTAGGGCAGGCCTGG + Intronic
1000280884 5:159780986-159781008 CAGGGGTTTGTGGGGAGGGAGGG - Intergenic
1001412188 5:171519677-171519699 CAGGTGTTTTTGGGAAGGTGTGG + Intergenic
1002510276 5:179711496-179711518 TAGGTGTTTTTGGCCAGGCATGG + Intronic
1003504921 6:6733049-6733071 CAGGAGTTAGAGGGGAGGGAAGG + Intergenic
1004072432 6:12312882-12312904 GAGCTCTTGTAGGGGAGGCACGG + Intergenic
1004592534 6:17067545-17067567 CAGGTGTTTTAGAAGAGGAATGG + Intergenic
1004942738 6:20578085-20578107 TAGGTGGTTTAGGGGAAGGAAGG - Intronic
1005437988 6:25835823-25835845 CAGGTTTTGAAGGGAAGGCATGG + Intronic
1005602633 6:27443315-27443337 CAGGTGTCTTAGAGGAGCTAGGG - Intergenic
1005869807 6:29966339-29966361 CAGGAGGTCTTGGGGAGGCAAGG - Intergenic
1006793164 6:36716658-36716680 CAGGTGTTGTGAGGCAGGCAGGG + Intronic
1007442818 6:41878238-41878260 CAGGTGTTCTGGGGCAGGCTGGG + Intronic
1008011443 6:46471943-46471965 TAGGTGCTCTAGGGGAGGTAGGG - Intronic
1008121488 6:47622190-47622212 CAGGGCTGTTGGGGGAGGCACGG - Intronic
1008257361 6:49320294-49320316 AAGTTGATTTATGGGAGGCATGG - Intergenic
1008329426 6:50227479-50227501 GAGCTGTTTTAGGGCAGGCCTGG + Intergenic
1008350072 6:50479461-50479483 GAGCTGTTTTAGGGCAGGCCTGG - Intergenic
1008729044 6:54457702-54457724 GAGCTGTTGTAGGGCAGGCATGG + Intergenic
1009035633 6:58114567-58114589 CAGGTGATTCAGGGGAGGTTGGG + Intergenic
1009211455 6:60868160-60868182 CAGGTGATTCAGGGGAGGTTGGG + Intergenic
1010484462 6:76392470-76392492 CAGCTCTTTTAGGGCAGGCCTGG - Intergenic
1010594220 6:77744937-77744959 GAGCTCTTTTAGGGCAGGCATGG - Intronic
1010633340 6:78227116-78227138 GAGCTCTTTTAGGGCAGGCATGG - Intergenic
1010957181 6:82103130-82103152 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
1011244621 6:85308997-85309019 GAGCTCTTTTAGGGGAGGCCTGG - Intergenic
1011358354 6:86496280-86496302 GAGGTCTTTTAGGGCAGGCCTGG + Intergenic
1012176947 6:96098843-96098865 CAGGGGATTTAGATGAGGCATGG + Intronic
1014120859 6:117723252-117723274 GAGCTGTTTTAGGGCAGGCCTGG - Intergenic
1014145885 6:117997742-117997764 GAGCTGTTTTAGGGCAGGCCTGG - Intronic
1015191570 6:130477470-130477492 GAGCTCTTTTAGGGGAGGCCTGG - Intergenic
1015606658 6:134963413-134963435 GAGGTTTTTTATGGGTGGCAGGG + Exonic
1015989940 6:138929273-138929295 CAGGTGTTTTAGGGGAGGCAGGG + Intronic
1017506194 6:155070879-155070901 AATATTTTTTAGGGGAGGCATGG + Intronic
1018040861 6:159921023-159921045 CAGGAATTTTGGGGGAGGCAGGG - Intergenic
1018245964 6:161824083-161824105 CAGGTGTTTCAGTGTAAGCATGG + Intronic
1018636198 6:165861446-165861468 CAGGTGCTGGAGGAGAGGCAGGG + Intronic
1018978096 6:168580820-168580842 ATGGTGTTTTAGGCCAGGCATGG - Intronic
1019178458 6:170172954-170172976 TAGCTGATTTGGGGGAGGCAGGG + Intergenic
1022103289 7:27181835-27181857 CCGGTGTTTTGGGGGACTCAAGG + Exonic
1022343108 7:29486814-29486836 CAGGTGTTTTAGTGGGAGCGTGG - Intronic
1023053981 7:36277179-36277201 CAGGTGGAACAGGGGAGGCAGGG - Intronic
1023552270 7:41383041-41383063 CATGTATTTTAGGCCAGGCATGG - Intergenic
1025093934 7:56083569-56083591 CTGGGGTCTCAGGGGAGGCAGGG - Intronic
1026262723 7:68769704-68769726 CAGCTGTGTTAGGGGAGGTGGGG + Intergenic
1027493474 7:78859413-78859435 GAGGTCTTTTAGGGCAGGCCTGG + Intronic
1027496136 7:78889696-78889718 GAGGTCTTTTAGGGCAGGCCTGG - Intronic
1027682127 7:81233794-81233816 CAGCTGCTGCAGGGGAGGCATGG - Intergenic
1028532498 7:91852765-91852787 CAGGTGTTTTCAGGGGGCCAAGG - Intronic
1030177920 7:106673701-106673723 GAGCTGTTTTAGGGCAGGCCTGG - Intergenic
1031005532 7:116466711-116466733 CAGGAGTTTAAGGGAAGGGAAGG + Intronic
1031049117 7:116927383-116927405 CAGGGGTTGCAGGGGTGGCAGGG - Intergenic
1033917848 7:146349642-146349664 GAGGTCTTTTAGGGCAGGCCTGG + Intronic
1034350066 7:150409670-150409692 CAGGGGTGTTAGGGGTGGTACGG + Intronic
1035767131 8:2115468-2115490 CAGGGGTTTCAGGTGAGGAAAGG - Intronic
1035886041 8:3293000-3293022 GAGGTCTTTTAGGGCAGGCCTGG + Intronic
1035921295 8:3679002-3679024 GAGGTCTTTTAGGGGAGGTCTGG - Intronic
1036604138 8:10291675-10291697 CAGGTGTTTGAAGGGAGAAAGGG - Intronic
1036790077 8:11711363-11711385 CAAGTGTTTTAGGAGAGGTGCGG + Intronic
1037925274 8:22839326-22839348 CAGGGGCTTTGGGGGTGGCATGG + Intronic
1038015074 8:23508027-23508049 TAGGCCTTTTAGGGGAGACAAGG - Intergenic
1038748362 8:30273731-30273753 CAGGTGTTTTGGGAGAGACCGGG + Intergenic
1039207680 8:35175656-35175678 GAGGTCTTTTAGGGCAGGCCTGG + Intergenic
1039238775 8:35532220-35532242 GAGGTCTTTTAGGGCAGGCCTGG + Intronic
1039300002 8:36199432-36199454 GAGGTCTTTTAGGGCAGGCCTGG + Intergenic
1039334855 8:36577574-36577596 CACGAGTTTTATGGGAGTCATGG - Intergenic
1039767812 8:40648892-40648914 GAGCTGTTTTAGGGCAGGCCTGG - Intronic
1040405592 8:47099133-47099155 CAGCTCTTTTAGGGCAGGCCTGG + Intergenic
1040523919 8:48201467-48201489 CACGCGTGTTAGGGGAGGCCTGG - Intergenic
1040591582 8:48798079-48798101 GAGCTCTTTTAGGGCAGGCATGG + Intergenic
1040686504 8:49879296-49879318 GAGCTCTTTTAGGGCAGGCATGG + Intergenic
1042157429 8:65860450-65860472 CAGGAGTTCAAGGGGAGGGAGGG - Intergenic
1042439794 8:68811518-68811540 CAGCTGTAGTAGGGGAGGCGTGG - Intronic
1042526205 8:69767599-69767621 AAGCTGTTTTAGGCCAGGCATGG + Intronic
1044183169 8:89220144-89220166 GAGCTCTTTTAGGGGAGGCCTGG - Intergenic
1044195894 8:89375870-89375892 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
1044279010 8:90335129-90335151 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
1045248262 8:100461864-100461886 AAGGTGTCATAGTGGAGGCATGG + Intergenic
1045775068 8:105793259-105793281 GAGCTGTTTTAGGGCAGGCCTGG + Intronic
1046968287 8:120192219-120192241 GAGCTCTTTTAGGGCAGGCATGG + Intronic
1046982366 8:120350204-120350226 GAGCTCTTTTAGGGCAGGCATGG - Intronic
1047837587 8:128711245-128711267 GAGGTCTTTTAGGGCAGGCCTGG + Intergenic
1047838120 8:128716187-128716209 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
1047841849 8:128761811-128761833 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
1048626235 8:136188477-136188499 CAGATGTTTTCTGAGAGGCAGGG + Intergenic
1050688892 9:8203148-8203170 GAGCTGTTTTAGGGCAGGCCTGG + Intergenic
1050824880 9:9933045-9933067 GAGCTGTTTTAGGGCAGGCCTGG - Intronic
1051804962 9:20982054-20982076 GAGGTCTTTTGGGGGAGGGAAGG - Intronic
1051879220 9:21823287-21823309 GAGCTCTTTTAGGGCAGGCATGG + Intronic
1052445301 9:28553966-28553988 CAGCTCTTTTAGGGCAGGCCTGG - Intronic
1052821507 9:33141149-33141171 CAGGTGGTATAGGGCATGCAGGG + Intronic
1054898180 9:70337662-70337684 CAGGAGTTTGAGGCCAGGCATGG - Intronic
1055010278 9:71558236-71558258 CAGGTGGGTGAGGGCAGGCAAGG - Intergenic
1056616215 9:88168244-88168266 CAGGAGTTTGAGGGGAGCCTGGG + Intergenic
1056887060 9:90453302-90453324 CATGTTTTTTAAGTGAGGCATGG - Intergenic
1057032159 9:91784119-91784141 CAGGTGTGTAACGGGAGGCCGGG - Intronic
1058274895 9:103027787-103027809 CAGGTCTGTTACTGGAGGCATGG - Intergenic
1058426729 9:104881929-104881951 AAGCTGTCTTAGGGGTGGCATGG - Intronic
1058828305 9:108794210-108794232 AAGGTGTCTGAGGGGATGCATGG - Intergenic
1061807691 9:133145563-133145585 CAGATGTGTGAGGGGAGACAAGG + Intronic
1203374031 Un_KI270442v1:348003-348025 GAGCTTTTTTAGGGCAGGCATGG + Intergenic
1186053445 X:5624457-5624479 CAGGTGTTGAAGGAGAGGCCTGG + Intergenic
1186442020 X:9594710-9594732 CAGATATTTTAGGGAAGACAGGG + Intronic
1186963042 X:14758001-14758023 TAGGTGCTGTTGGGGAGGCACGG + Intergenic
1187736111 X:22305247-22305269 CAGGTGATTCAGGGCAGGCCAGG - Intergenic
1190013982 X:46810791-46810813 CAGGTGTTGTAGGAGGGGCCTGG - Intergenic
1191125799 X:56952913-56952935 GAGGTCTTTTAGGGGAGGCCTGG + Intergenic
1191586043 X:62827772-62827794 TAGGTGCTTTTGGTGAGGCATGG - Intergenic
1191625363 X:63265250-63265272 GAGGTCTTTTAGGGCAGGCCTGG + Intergenic
1191635300 X:63369377-63369399 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
1191647156 X:63494057-63494079 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
1191649505 X:63521081-63521103 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
1191681097 X:63840595-63840617 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
1191687056 X:63902847-63902869 GAGGTCTTTTAGGGCAGGCCTGG + Intergenic
1192071422 X:67944489-67944511 GAGCTCTTTTAGGGGAGGCCTGG - Intergenic
1192136354 X:68604213-68604235 GAGCTCTTTTAGGGGAGGCCTGG - Intergenic
1192155004 X:68738204-68738226 GAGTTCTTTTAGGGGAGGCCTGG - Intergenic
1193015116 X:76724205-76724227 CAGCTCTTTTAGGGCAGGCCTGG + Intergenic
1193018005 X:76757528-76757550 CAGTTCTTTTAGGGCAGGCCTGG - Intergenic
1193033696 X:76926325-76926347 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
1193059177 X:77186419-77186441 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
1194271667 X:91823848-91823870 CAGCTCTTTTAGGGCAGGCCTGG + Intronic
1194570757 X:95551778-95551800 CAGGTTTTTCAGGGAAAGCAGGG + Intergenic
1196474586 X:116068070-116068092 GAGCTCTTTTAGGGGAGGCCTGG + Intergenic
1197748033 X:129946117-129946139 CTGGGGTTCTAGGAGAGGCATGG - Intergenic
1197957024 X:131962408-131962430 GAGGTTTTTTAGGGCAGGCCTGG + Intergenic
1198122696 X:133609841-133609863 CTAGTGTTTTAGGGGATGAAAGG - Intronic
1198339204 X:135698029-135698051 CAGGTATTCTAGGTGAGGTAGGG + Intergenic
1199288506 X:146080444-146080466 TAGGTGTTTTCTGGTAGGCAGGG - Intergenic
1199460125 X:148075067-148075089 CAGGCCTTGTAGGAGAGGCAAGG - Intergenic
1199549991 X:149050425-149050447 CAGGTATTTTAGGCTGGGCATGG + Intergenic
1200357801 X:155569803-155569825 GAGCTGTTTTAGGGCAGGCCTGG - Intronic
1200588913 Y:5045285-5045307 CAGCTCTTTTAGGGCAGGCCTGG + Intronic
1200903489 Y:8457568-8457590 GAGCTCTTTTAGGGGAGGCCTGG + Intergenic
1201246706 Y:12011551-12011573 CAGCTCTTTTAGGGCAGGCCTGG + Intergenic
1201258787 Y:12136815-12136837 GAGCTGTTTTAGGGCAGGCCTGG - Intergenic
1201413444 Y:13723905-13723927 GAGGTCTTTTAGGGCAGGCCTGG - Intergenic
1201449719 Y:14098454-14098476 CAGCTCTTTTAGGGCAGGCCTGG + Intergenic
1201478568 Y:14411546-14411568 CAGGTGCTTTAGAGGAAGCTGGG - Intergenic