ID: 1015999653

View in Genome Browser
Species Human (GRCh38)
Location 6:139029519-139029541
Sequence GGCACCGCTGGCGCCCGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015999653_1015999674 30 Left 1015999653 6:139029519-139029541 CCTTCCCGGGCGCCAGCGGTGCC 0: 1
1: 0
2: 0
3: 19
4: 167
Right 1015999674 6:139029572-139029594 CCCCAGCCCTGCACTGGTGCCGG 0: 1
1: 0
2: 0
3: 68
4: 482
1015999653_1015999658 -10 Left 1015999653 6:139029519-139029541 CCTTCCCGGGCGCCAGCGGTGCC 0: 1
1: 0
2: 0
3: 19
4: 167
Right 1015999658 6:139029532-139029554 CAGCGGTGCCGCCCCGCCACGGG No data
1015999653_1015999661 -7 Left 1015999653 6:139029519-139029541 CCTTCCCGGGCGCCAGCGGTGCC 0: 1
1: 0
2: 0
3: 19
4: 167
Right 1015999661 6:139029535-139029557 CGGTGCCGCCCCGCCACGGGGGG 0: 1
1: 0
2: 1
3: 5
4: 81
1015999653_1015999659 -9 Left 1015999653 6:139029519-139029541 CCTTCCCGGGCGCCAGCGGTGCC 0: 1
1: 0
2: 0
3: 19
4: 167
Right 1015999659 6:139029533-139029555 AGCGGTGCCGCCCCGCCACGGGG No data
1015999653_1015999672 24 Left 1015999653 6:139029519-139029541 CCTTCCCGGGCGCCAGCGGTGCC 0: 1
1: 0
2: 0
3: 19
4: 167
Right 1015999672 6:139029566-139029588 CGCGCTCCCCAGCCCTGCACTGG 0: 1
1: 0
2: 0
3: 32
4: 281
1015999653_1015999660 -8 Left 1015999653 6:139029519-139029541 CCTTCCCGGGCGCCAGCGGTGCC 0: 1
1: 0
2: 0
3: 19
4: 167
Right 1015999660 6:139029534-139029556 GCGGTGCCGCCCCGCCACGGGGG 0: 1
1: 0
2: 0
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015999653 Original CRISPR GGCACCGCTGGCGCCCGGGA AGG (reversed) Intronic