ID: 1016005007

View in Genome Browser
Species Human (GRCh38)
Location 6:139080173-139080195
Sequence CTTTCTAATCAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016004998_1016005007 29 Left 1016004998 6:139080121-139080143 CCAGAACCCGAGCTGTAAGGGGG No data
Right 1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG No data
1016005001_1016005007 23 Left 1016005001 6:139080127-139080149 CCCGAGCTGTAAGGGGGTTTGGA No data
Right 1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG No data
1016005002_1016005007 22 Left 1016005002 6:139080128-139080150 CCGAGCTGTAAGGGGGTTTGGAA No data
Right 1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016005007 Original CRISPR CTTTCTAATCAGAAGGAGGA GGG Intergenic
No off target data available for this crispr