ID: 1016010218

View in Genome Browser
Species Human (GRCh38)
Location 6:139131725-139131747
Sequence CTTCAGAAATGGTGGGAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016010212_1016010218 16 Left 1016010212 6:139131686-139131708 CCACCTTTTGTCTTTTGGTATGC No data
Right 1016010218 6:139131725-139131747 CTTCAGAAATGGTGGGAAAACGG No data
1016010210_1016010218 23 Left 1016010210 6:139131679-139131701 CCATCTGCCACCTTTTGTCTTTT No data
Right 1016010218 6:139131725-139131747 CTTCAGAAATGGTGGGAAAACGG No data
1016010213_1016010218 13 Left 1016010213 6:139131689-139131711 CCTTTTGTCTTTTGGTATGCTGT No data
Right 1016010218 6:139131725-139131747 CTTCAGAAATGGTGGGAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016010218 Original CRISPR CTTCAGAAATGGTGGGAAAA CGG Intergenic
No off target data available for this crispr