ID: 1016011240

View in Genome Browser
Species Human (GRCh38)
Location 6:139139439-139139461
Sequence ACAGCTAATACTTCGTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 39}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016011240_1016011244 23 Left 1016011240 6:139139439-139139461 CCAGCTTACGAAGTATTAGCTGT 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1016011244 6:139139485-139139507 CTGAGCAGAGATACACGTGCTGG 0: 1
1: 0
2: 2
3: 13
4: 119
1016011240_1016011245 26 Left 1016011240 6:139139439-139139461 CCAGCTTACGAAGTATTAGCTGT 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1016011245 6:139139488-139139510 AGCAGAGATACACGTGCTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 106
1016011240_1016011241 -7 Left 1016011240 6:139139439-139139461 CCAGCTTACGAAGTATTAGCTGT 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1016011241 6:139139455-139139477 TAGCTGTTTGTCTTAGATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016011240 Original CRISPR ACAGCTAATACTTCGTAAGC TGG (reversed) Intronic
1081881693 11:46458376-46458398 ACAGCTAATAGTGTGTAGGCAGG - Intronic
1085331325 11:75654192-75654214 ATAGTTAATACATGGTAAGCAGG + Intronic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1115162930 14:30416149-30416171 ACAGCTAATCCTTTGGAATCAGG - Intergenic
1117731971 14:58732072-58732094 ACAGCTAATAGTTTGTAGACTGG + Intergenic
1123461857 15:20479844-20479866 ACAGACAATACTACGTCAGCGGG - Intergenic
1123656199 15:22520538-22520560 ACAGACAATACTACGTCAGCGGG + Intergenic
1124310109 15:28615714-28615736 ACAGACAATACTACGTCAGCGGG + Intergenic
1128409568 15:67380902-67380924 ACAACTACTACTTGGTAATCAGG + Intronic
1130814001 15:87411385-87411407 AGAGCTGATTCTTGGTAAGCTGG + Intergenic
1138707430 16:58930999-58931021 ACAGCTAATACTTATTAATGAGG + Intergenic
1140579093 16:76207502-76207524 ACAGCTAAGACAGAGTAAGCAGG + Intergenic
1153693932 18:7621213-7621235 ATAGCTAATAATTGGTAAACTGG + Intronic
1154950141 18:21201976-21201998 CCATCTAATACTTTGGAAGCAGG - Intergenic
1155349460 18:24892238-24892260 ATAGCTAATACTTAGTGAGAAGG + Intergenic
1156083577 18:33371523-33371545 ACAGCTTATACTCCATAACCAGG - Intronic
1162560376 19:11414697-11414719 AAAGATGATACTTCCTAAGCAGG + Intronic
1167634788 19:50648342-50648364 AGAACGAATACTTAGTAAGCAGG + Intronic
925522031 2:4757475-4757497 ACAGCTAATACTGTGTAATTAGG + Intergenic
927974230 2:27326068-27326090 ATTGGGAATACTTCGTAAGCAGG + Exonic
1177246838 21:18536890-18536912 GCAGCTAATACTTCTCAAGCTGG + Intergenic
1178977729 21:37233963-37233985 ACAGCAGCTACTTTGTAAGCGGG + Intronic
1183779844 22:39992258-39992280 ACAGCTAATATTAGGAAAGCTGG + Intergenic
951277426 3:20705540-20705562 ACAGCTAATAACTTGTAAACAGG - Intergenic
954066613 3:48111736-48111758 ACAGCTGATACTTCGTACCATGG - Intergenic
954563918 3:51582216-51582238 ACAGCTATAACTTCTTAAGCTGG - Intronic
975984698 4:80191648-80191670 ACTGCTAATACTTGGAAAGGTGG - Intronic
983679559 4:170337274-170337296 ACAACTAATTCTTGGCAAGCAGG - Intergenic
988414971 5:30934854-30934876 GCAGCTAATATTTCTTAATCTGG - Intergenic
990550538 5:56872970-56872992 TCAGCTAAATCTTTGTAAGCAGG - Exonic
1012500923 6:99887340-99887362 ACAGCTGATACTTCATCAGTAGG - Intergenic
1016011240 6:139139439-139139461 ACAGCTAATACTTCGTAAGCTGG - Intronic
1022892073 7:34711720-34711742 ACAGCTAACATTTCTTGAGCAGG - Intronic
1023095358 7:36654726-36654748 CCAGCTAATTCCTCATAAGCAGG - Intronic
1038404582 8:27311674-27311696 CCAGCCACTACTTCGGAAGCAGG - Exonic
1040677589 8:49769000-49769022 ACAGCTAATAGTTTGTCAGGTGG - Intergenic
1045398407 8:101785205-101785227 ATAGCTAACACTTAGGAAGCTGG - Intronic
1047392854 8:124467766-124467788 ACAGCTAAATCTTGGTAAACAGG + Intergenic
1051868575 9:21710598-21710620 ACAGATATTTCTTCGTAGGCCGG + Intergenic
1053158737 9:35798942-35798964 ACATCTATTACTCAGTAAGCAGG + Intronic
1059952794 9:119484187-119484209 ACATCTATGACTTAGTAAGCAGG + Intergenic
1061101418 9:128495399-128495421 AGAGCTAGTACCTAGTAAGCAGG + Intronic
1186318936 X:8403044-8403066 ACTGCTAAGACTTGGTCAGCAGG + Intergenic
1196123635 X:112077159-112077181 ACAGCTAGTAATTCGTGAGCAGG + Intronic