ID: 1016012127

View in Genome Browser
Species Human (GRCh38)
Location 6:139148221-139148243
Sequence AGCAAAGACAACCATAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 525}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016012127 Original CRISPR AGCAAAGACAACCATAAATA AGG (reversed) Intronic
901138092 1:7010484-7010506 AGCCAAGATAACAAAAAATAAGG - Intronic
903635304 1:24810040-24810062 AGCAAAGAAAATCAGAAAAAAGG - Intronic
904930981 1:34087278-34087300 AGCAATCACAGCCATAAAAAAGG + Intronic
906401712 1:45509233-45509255 AGCAAGTACCACCATAAATCAGG - Exonic
908266282 1:62382335-62382357 AGCAAAGACATGAATAACTAAGG - Intergenic
908862318 1:68503386-68503408 AGCAAAGAAAAACATAAAGTAGG + Intergenic
908932453 1:69333090-69333112 TTCAAAGACAACAATAAAGAAGG - Intergenic
909236377 1:73157380-73157402 AGCAAAGAAAACAATCAACAGGG + Intergenic
909390175 1:75111534-75111556 AGCAAAGCCACCAAGAAATATGG - Intergenic
909801550 1:79815974-79815996 AGAAAAAAAATCCATAAATAAGG - Intergenic
909908199 1:81225165-81225187 ATCAAAATCAACCATATATATGG + Intergenic
910230966 1:84986168-84986190 AGCAAACAAAACCATAAAGTGGG + Intronic
910344370 1:86218980-86219002 AGAAAAGAAAACCATATTTAAGG + Intergenic
910734428 1:90436858-90436880 ACCAAAAATAACCATAAAAAAGG + Intergenic
911156398 1:94641786-94641808 AACAATGACACCCACAAATAAGG - Intergenic
912861356 1:113216646-113216668 AGCAAAGACAACCAATAATTTGG + Intergenic
913065147 1:115244934-115244956 AGCAAAGAAAATAATAAATGTGG + Intergenic
913607533 1:120479635-120479657 AACAAAGACTCCAATAAATATGG + Intergenic
914142807 1:144965961-144965983 AGCAAAGCCTCCAATAAATATGG + Intronic
914208894 1:145560503-145560525 AACAAAGACTCCAATAAATATGG - Intergenic
914369280 1:147007990-147008012 AACAAAGACTCCAATAAATATGG + Intergenic
914583658 1:149042199-149042221 AACAAAGACTCCAATAAATATGG - Intronic
916396427 1:164393593-164393615 AGCAAAACCAAAAATAAATAGGG + Intergenic
916462682 1:165043180-165043202 AGCCAAGACCTACATAAATATGG - Intergenic
917204542 1:172558452-172558474 AACAAAAACAAAAATAAATAGGG + Intronic
917671393 1:177276672-177276694 AACAAAGATAAACATAATTAAGG + Intronic
918995604 1:191755090-191755112 AGAAAAGACAACTATGATTAAGG + Intergenic
919933679 1:202237378-202237400 AGCAGGGACAGCCAAAAATAAGG + Intronic
920075958 1:203336936-203336958 AGGAAAGACAAGCAGAAACATGG - Intergenic
920931077 1:210388711-210388733 AGTAAAGAAAACCATTAATGAGG - Intronic
921732063 1:218589752-218589774 AGGAATTTCAACCATAAATAGGG - Intergenic
922315794 1:224440691-224440713 AGGAAAGAAAAGCATAAACAGGG + Intronic
923204706 1:231747229-231747251 AGCAAAGAAAACAATCAACAAGG - Intronic
923669065 1:236024683-236024705 ATCAAAGACAACCGAAAAAAGGG + Intronic
923884972 1:238144630-238144652 GGCAAAGAAATCCATAAAGATGG + Intergenic
923993428 1:239465292-239465314 AGCAAAGAAAAGCAAAAATCTGG + Intronic
924070159 1:240268991-240269013 TGCAGAGACAACCACAAATTGGG - Intronic
924314206 1:242778742-242778764 AGCAAAGAACATCATAAACAAGG + Intergenic
1063105396 10:2987723-2987745 AGCACACACAACCAGAAAGAAGG - Intergenic
1063328531 10:5131059-5131081 AGCAAACAAAAACATAAATTGGG + Intronic
1064554188 10:16532214-16532236 AGAAAATACAAGAATAAATATGG + Intergenic
1064704408 10:18056873-18056895 AGCAGACACAGCCATATATAGGG + Intergenic
1064955520 10:20904176-20904198 AGAAAGGAAAACCATAGATAAGG + Intronic
1065908367 10:30279594-30279616 TGTAAAGACACCCAAAAATATGG + Intergenic
1066141903 10:32512595-32512617 AGAAAATAAAACCATAAAAAGGG + Intronic
1066143368 10:32530036-32530058 AGCAAAGAAAAACATAAAGTGGG - Intronic
1067659062 10:48220313-48220335 AGCAAACAAAAACATAAAGAGGG + Intronic
1068184479 10:53566883-53566905 AGCAAACAAAACCATAAAGTGGG + Intergenic
1068670877 10:59722286-59722308 AGCAAAGAAAAGCATAAAGTGGG - Intronic
1069004923 10:63306799-63306821 AGTAAATACAATGATAAATAAGG + Intronic
1069154411 10:65008949-65008971 AGCACATATAACCATATATATGG + Intergenic
1069339768 10:67397087-67397109 TGTAAAGACACCCAAAAATATGG + Intronic
1069345407 10:67463641-67463663 AGCATCTACAACTATAAATAAGG + Intronic
1070122004 10:73586756-73586778 AGCATCTACAACCATAAAAAGGG + Intronic
1072399304 10:95080547-95080569 AGCAAAGCCACCAAGAAATATGG + Intergenic
1073485720 10:103817857-103817879 AGAAAAGGCAAACATATATAGGG + Intronic
1073975396 10:109095149-109095171 AACAAAGACACCAAGAAATATGG - Intergenic
1076556528 10:131325509-131325531 AGCAAAGAAAGCACTAAATATGG + Intergenic
1077548811 11:3190182-3190204 TGCAAAGACACAAATAAATAGGG + Intergenic
1077859100 11:6159348-6159370 AGCAAAAACAAACAAAAAAATGG - Intergenic
1077957530 11:7037026-7037048 AGGAAAGACAAAGATAAAGATGG + Intronic
1078284966 11:9943433-9943455 AGAAAAGACAACCACAAACTAGG + Intronic
1079179876 11:18182161-18182183 AGCAAACAAAAACATAAAGAGGG + Intronic
1079740243 11:24049880-24049902 AGCACACACAAACATAAAGATGG + Intergenic
1079956651 11:26874626-26874648 AGCAAACAAAAACATAAATTGGG + Intergenic
1080558634 11:33440700-33440722 AGCAAGGAAAACTATAAATGTGG - Intergenic
1081302776 11:41473379-41473401 TTCAAAAACAACCACAAATATGG + Intergenic
1081419407 11:42855442-42855464 AGCAAACAAATACATAAATAAGG + Intergenic
1082198959 11:49339770-49339792 AACAAAGACAACCATAAAGTAGG + Intergenic
1082859522 11:57841178-57841200 AGCAAAAACATCCATCAATAGGG - Intergenic
1083210218 11:61179663-61179685 AGCAAAGAAAACAATCAACAAGG - Intergenic
1083530041 11:63412141-63412163 AGCATACAAAAACATAAATAGGG + Intergenic
1084905507 11:72343246-72343268 CACAAAGGCAGCCATAAATAAGG - Intronic
1085936707 11:81154461-81154483 AGGAAAGACAACCCTATATAAGG + Intergenic
1086212687 11:84340049-84340071 AGTAAACACAGCCAGAAATATGG + Intronic
1086433157 11:86755591-86755613 AGCAAAGACAACTCTAAACATGG + Intergenic
1086656853 11:89368317-89368339 AACAAAGACAACCATAAAGTAGG - Intronic
1086791853 11:91049645-91049667 AGCAAAGAAAACAATAAACATGG + Intergenic
1087391039 11:97535619-97535641 AACAAACACAAACATATATAAGG - Intergenic
1087447178 11:98269596-98269618 TTCAAAGATAACCAAAAATATGG - Intergenic
1088286758 11:108198186-108198208 AGCTAAGACAACAACAAACATGG + Intronic
1089900459 11:121977486-121977508 AGCAAAGAAAAACATAAAATGGG + Intergenic
1090130720 11:124138747-124138769 AGCAAAGAAAACAATCAACAGGG - Intronic
1090340436 11:126014647-126014669 ATTAAAAACAACCATCAATAAGG + Intronic
1090688607 11:129153612-129153634 AGCAAACAAAAACATAAATTGGG + Intronic
1091510769 12:1123192-1123214 AGAAAATACAAGCATAAGTATGG + Intronic
1092643301 12:10540610-10540632 AGCAAAATAAACCATCAATAGGG + Intergenic
1093720978 12:22441831-22441853 AGCAAACAAAACCATAAAGTGGG + Intergenic
1094649949 12:32366024-32366046 AACAAAGACCACCATATAAAAGG + Intronic
1094778713 12:33764201-33764223 AGCAAACAAAAACATAAATTGGG + Intergenic
1097081158 12:56432201-56432223 AGGAAAGAAAACCATGAATAAGG + Intronic
1097099377 12:56575925-56575947 AGAAAGTAAAACCATAAATAAGG - Intronic
1097256961 12:57684563-57684585 AGCAAACAAAAACATAAATCGGG - Intergenic
1097477735 12:60079752-60079774 AGCATAGAAAAACATAAATTGGG - Intergenic
1097547332 12:61020950-61020972 AGCAAACAAAACCATAAAGTGGG - Intergenic
1097906543 12:64925615-64925637 AGCATACAAAAACATAAATAGGG - Intergenic
1098943431 12:76562999-76563021 AGCAACCTCAGCCATAAATAAGG + Intergenic
1099096644 12:78382481-78382503 AGCAAAGAATATGATAAATATGG - Intergenic
1099206131 12:79728953-79728975 AACAAAGATAAGCAAAAATATGG + Intergenic
1099305729 12:80953005-80953027 AGTAAAAACAAACATAGATATGG - Intronic
1099318466 12:81114522-81114544 AACAAAGACAACCATTGACAGGG - Intronic
1099548092 12:84010578-84010600 AGCAAAGCCTCCAATAAATATGG - Intergenic
1099796433 12:87406783-87406805 AGGAAAGACAACTAGAAACAAGG + Intergenic
1099809970 12:87568531-87568553 TGGAAAGACAAAAATAAATATGG + Intergenic
1099906248 12:88774633-88774655 AGCAAAGATTCCCATAAATCTGG + Intergenic
1100046691 12:90390777-90390799 AGGAAATACAAACATCAATAAGG + Intergenic
1100663756 12:96728794-96728816 AGCAGATAAAACCATAAAGATGG - Intronic
1101515841 12:105434439-105434461 AGCAATGCCAAGCAGAAATATGG - Intergenic
1102651850 12:114447886-114447908 ACAATAGACAACCAAAAATAAGG + Intergenic
1104559339 12:129829799-129829821 AGCCAAGACAGCAAAAAATAAGG + Intronic
1104863402 12:131937675-131937697 AGCAAAAACAAACAAAAAAACGG - Intronic
1105613464 13:21990100-21990122 AGCAAACACAAGCCTATATAAGG - Intergenic
1105904873 13:24797958-24797980 TTCAAAAACAATCATAAATAAGG - Intronic
1105990000 13:25610380-25610402 AGCAAAGAAAAACATAAAGTGGG - Intronic
1107826573 13:44333779-44333801 AGCAAATACAACCTCAAATAAGG + Intergenic
1108497741 13:51041986-51042008 AGCACAGACAGCCACAAAAATGG + Intergenic
1109283704 13:60387277-60387299 AGCACACACAGGCATAAATATGG + Intergenic
1109291101 13:60475999-60476021 AGCAAAGGAAACTATAAACAGGG - Intronic
1109710757 13:66156334-66156356 AACAAGGAGAACCATAAAAAAGG + Intergenic
1110097032 13:71539335-71539357 AGCAATGACAACCAAAGATTAGG + Intronic
1110722754 13:78783448-78783470 AGCAAATATAACAATATATAAGG - Intergenic
1110763678 13:79257876-79257898 AGATAAGACCACCATAAGTAGGG - Intergenic
1112687201 13:101843501-101843523 CTCAAAGTCAACCATACATATGG - Intronic
1112887275 13:104189844-104189866 AGCAAAGACAACGTTGAATGAGG - Intergenic
1112954041 13:105037624-105037646 GAAAAAGACAACAATAAATAAGG + Intergenic
1113002238 13:105654656-105654678 ACCAAAGATAACCAGAGATAAGG + Intergenic
1114698200 14:24647414-24647436 AACAAAGTCTACAATAAATATGG + Intergenic
1114934489 14:27516120-27516142 AGAAATGACAACCTTTAATACGG - Intergenic
1115130148 14:30045117-30045139 AGCAAACACAAACATAAGTGGGG + Intronic
1115299444 14:31867250-31867272 AGCAAAAACAAACAAAAACAAGG + Intergenic
1115440519 14:33429673-33429695 TCCAAATACATCCATAAATATGG - Intronic
1116088635 14:40275164-40275186 AGCAAACAAAAACATAAATGTGG - Intergenic
1116651317 14:47596429-47596451 ATCAAAGAAAAACATAAATATGG - Intronic
1117667238 14:58069329-58069351 AGGCAATACAACCATGAATATGG + Intronic
1118739233 14:68726788-68726810 AAAAAAGGCAACCATAAAGAAGG + Intronic
1118997667 14:70851610-70851632 AGCACACATAATCATAAATATGG - Intergenic
1119704286 14:76774321-76774343 AGCAAAGAACCCCATAAACAGGG - Intronic
1119774016 14:77237453-77237475 TGCAAAGGCAACCAAAAAAAGGG + Intronic
1119867595 14:77986812-77986834 AGCAAGAACAATCATAAAAAAGG - Intergenic
1120087500 14:80290757-80290779 AGCCAAGACAATCATGAAAAAGG - Intronic
1120444324 14:84575209-84575231 AATAAAGACAAACATATATAAGG - Intergenic
1121213126 14:92224222-92224244 AGCAAAAGCAACCATAATGAGGG - Intergenic
1121907519 14:97760576-97760598 AGTAAAGACAACCATATGCAAGG + Intronic
1123138157 14:106049723-106049745 TGAAAAGATAACCAAAAATATGG + Intergenic
1123995051 15:25712575-25712597 ACAAAAGAAAAACATAAATAGGG - Intronic
1124041407 15:26108933-26108955 AGCAAACAGAAACATAAAAAAGG + Intergenic
1124689816 15:31812417-31812439 AGCAAGGACAACTGTAAATGAGG - Intronic
1124718643 15:32092634-32092656 AACAAAGACAAAAATAAATCAGG - Intronic
1125427834 15:39567492-39567514 AGGAAAGAAAAACATAAATAAGG + Intergenic
1125839074 15:42781404-42781426 AGCTAAGACAAGCAGAAAGAAGG - Intronic
1126254235 15:46606390-46606412 TGCACAGAGAACCATAGATAAGG - Intergenic
1126486781 15:49189914-49189936 AGAAAACAAAACCACAAATAAGG + Intronic
1127090710 15:55464179-55464201 AGCAAACAAAACCATAAAGTGGG + Intronic
1127126113 15:55813465-55813487 TGCAAAAACAATCATAAATATGG + Intergenic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1127862006 15:63002268-63002290 AGTAAAGAGTAACATAAATATGG + Intergenic
1128188490 15:65666568-65666590 AGAAAGGAAAACCATGAATAAGG + Intronic
1129808471 15:78484956-78484978 AGAAAAGCCAACAATAATTAAGG - Intronic
1130919787 15:88334474-88334496 AGAAAAGAAAACAATAAATGAGG + Intergenic
1131444285 15:92483597-92483619 AGCAAAGGAAACAATAAACAGGG + Intronic
1132183823 15:99785450-99785472 TGAAAAGCCAATCATAAATAAGG + Intergenic
1132434560 15:101787715-101787737 TGAAAAGCCAATCATAAATAAGG - Intergenic
1133183660 16:4078941-4078963 GGCAAAGACAACGGCAAATAAGG + Intronic
1133841596 16:9415187-9415209 TTCAAAGACAAACATAAAAATGG + Intergenic
1133850489 16:9498986-9499008 AGCAATGTGTACCATAAATATGG + Intergenic
1135622052 16:23964362-23964384 CGCAAAGGCAGCCATAGATAAGG - Intronic
1135677735 16:24431336-24431358 ATCAAAGACAACCACAGATGTGG + Intergenic
1136924580 16:34359968-34359990 AGCAAAGGCAACTATACAAAGGG + Intergenic
1136979993 16:35051838-35051860 AGCAAAGGCAACTATACAAAGGG - Intergenic
1138144686 16:54597756-54597778 AGCAAGGACAACCACTGATAAGG - Intergenic
1138746491 16:59368672-59368694 AGAAAGGAAAACCATGAATAAGG + Intergenic
1139437439 16:66944402-66944424 AGCAAAGAAAACAAAATATAAGG + Exonic
1141537509 16:84692589-84692611 AACAAAGACATCCATATATCAGG + Intergenic
1142017211 16:87756113-87756135 AGCACAGACAACCACAAAGAGGG + Intronic
1142423368 16:89987217-89987239 AGCAAAGACAAAAATAAACCAGG + Intergenic
1142951339 17:3483440-3483462 AGCAAAGAGAACAAAACATACGG + Intronic
1144089950 17:11847168-11847190 AGCAAAGAAAACTATCAACAGGG - Intronic
1144799535 17:17915907-17915929 TGAAAAGACAACCATAAAATAGG - Intronic
1147698799 17:42378232-42378254 AACAAAAACAAGCATAATTAGGG - Intronic
1149106092 17:52967283-52967305 ATCAAAGACACTTATAAATATGG - Intergenic
1149180349 17:53928920-53928942 AGCAAAGAAAACAATCAACAAGG - Intergenic
1149282583 17:55124676-55124698 AGCAAATACAGCAATAAAAATGG - Intronic
1149337203 17:55648216-55648238 AGCAAAGAGAAAGATAAAGATGG + Intergenic
1150998523 17:70347130-70347152 AACAAAAACAAACAAAAATAAGG - Intergenic
1153173413 18:2343056-2343078 AAAAAAGAAAACTATAAATATGG + Intergenic
1153402279 18:4694271-4694293 AGCAAACAAAAACATAAATCGGG + Intergenic
1153497522 18:5715055-5715077 AGCAAAAACACCAATAAACATGG - Intergenic
1153945977 18:10017789-10017811 AACAACGACAACAATAAAAAAGG + Intergenic
1154114788 18:11603525-11603547 AGGACAGAAAACAATAAATATGG + Intergenic
1155633550 18:27923579-27923601 AGCAAAGGTAAGCAAAAATATGG - Intergenic
1156261503 18:35448694-35448716 AGCAAAGACAAAAGGAAATAAGG - Intronic
1156306066 18:35879172-35879194 AGGGAAGCCATCCATAAATAAGG + Intergenic
1156418259 18:36921822-36921844 ATAAAACACAACCATAACTAGGG - Intronic
1156564251 18:38165731-38165753 TACAAATGCAACCATAAATAAGG + Intergenic
1156884804 18:42122636-42122658 AGTAAAGAAAAGCATTAATATGG - Intergenic
1156928712 18:42615313-42615335 ACCAAACACAAAGATAAATATGG - Intergenic
1157442965 18:47724382-47724404 AGCAAAGGCAGTCATAAATCAGG + Intergenic
1157464913 18:47934954-47934976 AGCAAAAACTAACATGAATAAGG - Intergenic
1157945496 18:51975158-51975180 AGCAAACAAAACCATAAAGTGGG - Intergenic
1158087992 18:53676182-53676204 AGCCAAGAAAACAATAGATATGG - Intergenic
1158167755 18:54559534-54559556 AGCACACACGAACATAAATATGG - Intergenic
1158297529 18:56015224-56015246 AGCAAAGACTCCAAGAAATATGG - Intergenic
1159332443 18:67015315-67015337 AGAAAAGACAAACACATATAAGG - Intergenic
1159989540 18:74887734-74887756 ATTAAAGACAACTAAAAATATGG - Intronic
1160556048 18:79726006-79726028 AGCAGAGTCAAACATAAACAAGG - Intronic
1161731905 19:5965770-5965792 AGCAAAGGCATCCACAAATGGGG + Intronic
1163975013 19:20842460-20842482 AACAAAGACTACAAGAAATATGG + Intronic
1166459206 19:42971211-42971233 AGCAAACACAATTATAAATAAGG + Intronic
1166476152 19:43126478-43126500 AGCAAACACAATTATAAATAAGG + Intronic
1166779259 19:45332010-45332032 AACAAAGACAACCCTAATTGGGG + Intergenic
1168556077 19:57341073-57341095 AGGAAAGACAACCATACATCTGG - Intergenic
926454692 2:13051838-13051860 AACAAAGTCAATCAAAAATAGGG - Intergenic
927024712 2:19054536-19054558 AGCAAACACAAACATAAAGTGGG - Intergenic
927036327 2:19180727-19180749 AGCAAACACAAACATAAAATGGG - Intergenic
927361718 2:22243008-22243030 AGCAAAAACAATTAGAAATATGG - Intergenic
928662119 2:33513331-33513353 AACTAATACAACCATACATATGG + Intronic
929038771 2:37722929-37722951 AGAAAAGCCAACCTTACATAGGG + Intronic
929939939 2:46325953-46325975 TGCAAAGAAAACCATAATTATGG + Intronic
930906882 2:56580213-56580235 AGCAAAGAAAACAATCAACAGGG + Intergenic
931528315 2:63184212-63184234 AACAAAGACAAACAGAAAGAGGG - Intronic
932853246 2:75208139-75208161 AACAAAAACAAAGATAAATAGGG - Intergenic
932869571 2:75384500-75384522 ACTAAAGAAAACCATAATTAAGG - Intergenic
933111143 2:78401806-78401828 AGCAAACAAAAACATAAATTGGG + Intergenic
933146692 2:78862415-78862437 TGCAAAGAGAACCATAATCAGGG + Intergenic
933508341 2:83206776-83206798 AACAACAACAACAATAAATAAGG - Intergenic
933519186 2:83348808-83348830 AGCAAAGACTCCAAGAAATATGG + Intergenic
936906899 2:117546729-117546751 TGCAAAGACAATTATAAATTCGG + Intergenic
936938244 2:117858810-117858832 AGCAGAGACAACCCTAACTGAGG - Intergenic
939657209 2:144841781-144841803 AGAAAAGAAAAAGATAAATAGGG - Intergenic
940641645 2:156350654-156350676 TAGAAAGACAACCATAAAGAAGG - Intergenic
941182115 2:162271998-162272020 AGTAAAACCAACCATAAATTTGG - Intronic
941199187 2:162488450-162488472 AGCAAAGACCACCATCAATCAGG + Intronic
941672200 2:168306661-168306683 AGCAAACAAAACCAAAAATTAGG - Intergenic
942060400 2:172223998-172224020 AGCAAAAGCATCCATAACTAAGG - Intergenic
942575112 2:177355105-177355127 AGCAAAGAAAAACATAAAGTGGG - Intronic
942926630 2:181440748-181440770 TACAAATACAAACATAAATAAGG - Intergenic
943149558 2:184094686-184094708 AGCAAACAAAACCATAAAGTGGG - Intergenic
943278466 2:185899214-185899236 AGCAATGCAAATCATAAATAAGG - Intergenic
943467217 2:188242783-188242805 AGCAAAAACAACCATCAAAAAGG + Intergenic
944264989 2:197713774-197713796 AACAAGGACAAACAAAAATAGGG - Intronic
944306651 2:198187178-198187200 ACCAAAGACCACCATAGAGAAGG - Intronic
944509316 2:200448879-200448901 AGCAATGGAAACCATACATATGG - Intronic
944603398 2:201327049-201327071 AGCAAACAAAAACATAAATTGGG + Intronic
944886189 2:204064844-204064866 AGCAGAGGGAACCAAAAATAGGG + Intergenic
945362830 2:208912226-208912248 AGCAAAGAAAAGCATAAAGTGGG + Intergenic
947350898 2:229243726-229243748 ATCAAATAAAACAATAAATAAGG + Intronic
947887143 2:233582511-233582533 AGCAAAGCCTCCAATAAATATGG - Intergenic
1169322774 20:4647871-4647893 ACCAATGACAACCATACATAAGG + Intergenic
1169401773 20:5287680-5287702 AGCAAACAAAAACATAAAGAGGG + Intergenic
1169515017 20:6306872-6306894 AGCAGAGTCAAACATAAACAGGG - Intergenic
1169526616 20:6434519-6434541 AGCAAAATCAACTATGAATATGG + Intergenic
1169624576 20:7549861-7549883 AGCAAAGCAAACAATCAATAGGG - Intergenic
1169685995 20:8272472-8272494 AACAGAGACAACCATAAAGGTGG - Intronic
1170307039 20:14950038-14950060 AGCATAGACAACCCTAGAGATGG - Intronic
1170554105 20:17502017-17502039 GGCAAAGACAAACAGAAATTAGG + Intronic
1171019932 20:21575848-21575870 AGCTAAGAAAACCATCAATGTGG - Intergenic
1171280771 20:23895437-23895459 AGCAAACACAAACATAAAGTGGG + Intergenic
1171497591 20:25567224-25567246 AGCAAAGAGAACAAAGAATAGGG + Intronic
1171733296 20:28737982-28738004 AGCAAAGCCTACAAGAAATATGG + Intergenic
1172339074 20:34141913-34141935 AACAAAGCCATCAATAAATATGG - Intergenic
1175367127 20:58463357-58463379 GGCAGAGACAACTGTAAATAAGG - Intronic
1176317054 21:5256228-5256250 AACAAAGCCAACAAGAAATATGG - Intergenic
1176914914 21:14613575-14613597 AGCAAAAACATGCATAGATAAGG + Intronic
1176914961 21:14614632-14614654 AGCAAAAACATGCATATATAAGG + Intronic
1177300005 21:19231511-19231533 AGAAAAGTCAGCCATAATTAAGG - Intergenic
1177340559 21:19794657-19794679 AGCAAAGAAAAACAAAATTACGG - Intergenic
1177418849 21:20828798-20828820 AGCAAAACAATCCATAAATATGG - Intergenic
1178043469 21:28668142-28668164 ATTAAAGATAACCTTAAATAAGG + Intergenic
1178178800 21:30135091-30135113 AGCAAACAAAAACATAAATTGGG + Intergenic
1178366074 21:31989833-31989855 AGCAAAGACACCCACAGAAATGG - Intronic
1178733311 21:35125523-35125545 AGCAAACAAAAACATAAATTGGG + Intronic
1179118128 21:38513922-38513944 ACCAAAGTCAACAATAAAAAGGG + Intronic
1180715903 22:17872105-17872127 AGCAAAGCCAACCCTCACTAAGG + Intronic
1181766663 22:25097320-25097342 AACAAAGACCCCCATAAAAATGG + Intronic
1182168581 22:28203087-28203109 AGCATAGAAAACCATATCTACGG - Intronic
1182179423 22:28330395-28330417 GTCAAAGACGACCATAAATCTGG - Intronic
1182950145 22:34366605-34366627 AGCAAAGGAAACTATCAATAGGG - Intergenic
1184632260 22:45791487-45791509 ATCAAAAAAAATCATAAATAGGG + Intronic
1185183483 22:49378156-49378178 AGCAATGATATCCAAAAATAAGG + Intergenic
949338679 3:3005251-3005273 TGCAAAGACAAAAATAAAAAGGG - Intronic
949457474 3:4254137-4254159 AGCAAAAAAAACCACAAAGATGG + Intronic
949757068 3:7424233-7424255 AACAAAGACAACCACAACAATGG - Intronic
951111983 3:18814517-18814539 AGAAAAAAAAACCAAAAATATGG - Intergenic
951134870 3:19093446-19093468 AGCACACACAGACATAAATATGG - Intergenic
952434750 3:33261933-33261955 AGCAAACAAAAACATAAATTAGG - Intergenic
952995386 3:38876086-38876108 AGCAAACAAAAACATAAATTGGG + Intronic
953255263 3:41284470-41284492 AGCAAACAAAAACATAAAGAGGG + Intronic
953539866 3:43808196-43808218 AGCAAACAAAACCATAAAGTAGG + Intergenic
953566297 3:44034669-44034691 AGCAAGGACAACCAGACATGGGG - Intergenic
953968331 3:47327297-47327319 ATCAAAGACACCCAAAAATAAGG + Intronic
955108805 3:55927207-55927229 ATCTAAGACAAACCTAAATAGGG - Intronic
955667117 3:61362036-61362058 AGCCAAAACAACCTTAAAAAAGG + Intergenic
955916192 3:63911476-63911498 AGAAAAGACAACCATAAAGAGGG + Intronic
955987007 3:64584033-64584055 TTCAAAGACAACCAAAAAGAAGG + Intronic
957158767 3:76581158-76581180 AGCAAAGACAAACACATATAAGG + Intronic
957394875 3:79623667-79623689 AACAAAGACTACAAGAAATATGG + Intronic
957611316 3:82470730-82470752 ATAAAAGACTACCATAAATTGGG - Intergenic
957678266 3:83398460-83398482 AGCATACACAAACATAAATTGGG + Intergenic
957721234 3:84002308-84002330 AGCAAACACAAACATAAAGTGGG - Intergenic
957793889 3:84976982-84977004 AGCAAAGACAACAGTAAGTAAGG + Intronic
957970675 3:87377892-87377914 AGCTTAGCCAACCATAGATAGGG + Intergenic
958484259 3:94683562-94683584 AGCAAACAAAAACATAAATTGGG - Intergenic
958484402 3:94685218-94685240 AGCAAACAAAAACATAAATTGGG + Intergenic
958604937 3:96345175-96345197 AGCAAATAAAACCCTAAAAAGGG + Intergenic
958710786 3:97714665-97714687 AGAACAGACAACCCTAACTAGGG - Intronic
958771056 3:98426451-98426473 AGCAAAGAAAAACATAAAGTGGG + Intergenic
958928345 3:100183108-100183130 AGGAAAGACAACGAAATATAAGG + Intergenic
959274927 3:104266544-104266566 AGCAAACAAAAACATAAATTGGG - Intergenic
959320234 3:104864161-104864183 AGCTAAGACAACCAAGAAAAAGG + Intergenic
959463631 3:106657681-106657703 AGCAAACAAAAACATAAATTGGG + Intergenic
959731012 3:109602496-109602518 AGCAAAGAAAAACATAAACTGGG + Intergenic
960711525 3:120535124-120535146 AGCAAATGCAACCAAAAAAATGG + Intergenic
960748739 3:120921436-120921458 AGCAAAGGAAACCATCAACAAGG - Intronic
961112992 3:124301093-124301115 AACAAAGACAACCATAATTAGGG + Intronic
962104368 3:132375907-132375929 AGCAAAGACTCCAAGAAATATGG - Intergenic
963077807 3:141364030-141364052 AGAAATGACAACCATAGACAGGG + Intronic
963325573 3:143858976-143858998 AGCATACACAAACATAAATTCGG - Intergenic
963906977 3:150780639-150780661 AACAAAGACAACCAAATGTAAGG - Intergenic
964511435 3:157456692-157456714 AGAATAGAGAACCAGAAATAAGG - Intronic
964563244 3:158021010-158021032 AGCAAAGCCTACAAGAAATATGG + Intergenic
964586434 3:158310260-158310282 AGCAAAGACAACGATTACAAGGG - Intronic
964613281 3:158635845-158635867 AGCAAAGCCTACAAGAAATATGG + Intergenic
964867934 3:161282161-161282183 AGCAAACAAAAACATAAATTGGG + Intergenic
965385786 3:168044902-168044924 AGAAAACACAAAGATAAATATGG + Intronic
969859751 4:10026392-10026414 AGCAAAGACAATCCTATACAAGG - Intronic
970040749 4:11794093-11794115 AGCAAAGCCTACAAGAAATATGG + Intergenic
970065745 4:12091441-12091463 AGCAAAGCCTACAAGAAATATGG + Intergenic
970134269 4:12904759-12904781 AGCAAAGCCTACAAGAAATATGG + Intergenic
970316565 4:14833774-14833796 AGCACAGAAAATCAAAAATAAGG + Intergenic
970454339 4:16207234-16207256 AGAAAACACTGCCATAAATATGG + Intronic
970856632 4:20656703-20656725 AGCAAACAAAAACATAAATTGGG + Intergenic
971192906 4:24444670-24444692 AGCAAAGACCACCTTAAACTTGG + Intergenic
971511527 4:27432310-27432332 GCCAAAGACAGCCATAAATGAGG + Intergenic
972052632 4:34758494-34758516 AGAAAAGACCATCATAAAAAGGG + Intergenic
972349207 4:38220995-38221017 AGAAAAAACAACCCTAAAAACGG - Intergenic
973886949 4:55332025-55332047 ATCAAAGACAAATATAAATAGGG + Intergenic
973926077 4:55738965-55738987 AGCAAACAAAAACATAAATTGGG + Intergenic
974372718 4:61038446-61038468 AGCAAAGAAAAACATAAAGGGGG - Intergenic
974623733 4:64395580-64395602 ATCAAACAAAACCATAAAAAGGG + Intronic
974807845 4:66904088-66904110 AGCCAAGAAATCCATAAAAAAGG - Intergenic
975190830 4:71460120-71460142 AGCAAAAGAAATCATAAATAAGG - Intronic
975198678 4:71558035-71558057 ATCCTAGACAACCATAAACATGG - Intronic
975451452 4:74531560-74531582 AGCACAGATATTCATAAATAAGG - Intergenic
975467176 4:74722232-74722254 AGCAAAGCCTACAAGAAATATGG - Intergenic
976556680 4:86458643-86458665 AGCAAACAAAAACATAAAGAAGG + Intronic
976805391 4:89040684-89040706 AGCAAACCCAACAATAAAGAAGG + Intronic
977023827 4:91790701-91790723 AGCAAAGACTCCAAGAAATATGG - Intergenic
977048935 4:92102564-92102586 TGGGAAGACAGCCATAAATATGG - Intergenic
977063896 4:92289134-92289156 TGCAAAGATACCCAAAAATATGG - Intergenic
977256382 4:94745354-94745376 AGCAAAGGCAACAATCAATAGGG + Intergenic
977348828 4:95853556-95853578 AGTAAAGACAACTAGTAATATGG + Intergenic
977623871 4:99168438-99168460 AGCAAACAAAAACATAAATTGGG - Intergenic
977826476 4:101538222-101538244 AGCAAAGAAAAACATAAAGTGGG + Intronic
978397781 4:108300313-108300335 AGCAAACAAAAACATAAAGAGGG - Intergenic
978835372 4:113143068-113143090 ATAAAAGACAACCACAGATAGGG - Intronic
979345819 4:119585578-119585600 AGGAAAGAGAAAAATAAATATGG + Intronic
979961091 4:127021898-127021920 AGCAAAGCCTACAAGAAATATGG + Intergenic
980010621 4:127590266-127590288 AGCAAAGCCTACAAGAAATATGG + Intergenic
980263439 4:130484007-130484029 AACAAAAACAAAGATAAATAAGG + Intergenic
981795194 4:148588004-148588026 AGCAAACACAAACATAAAGTGGG - Intergenic
981992351 4:150937502-150937524 AAAAAATACAACCATAAAAAAGG - Intronic
982804083 4:159741447-159741469 AGCAAAGAAAAACATAAAGTAGG - Intergenic
982870687 4:160575366-160575388 AGCAAAGACTCCAAGAAATATGG + Intergenic
983054681 4:163087512-163087534 AGAAAAGGGAACCATAAATATGG + Intergenic
983082436 4:163403143-163403165 TGCAAAGAAAAAAATAAATATGG - Intergenic
983446511 4:167859219-167859241 AGCAAAGACTCCAAGAAATATGG + Intergenic
983825909 4:172259873-172259895 AGCAAACAAAAACATAAATTAGG - Intronic
983912392 4:173254362-173254384 ATCAAAGAGAACCTTTAATATGG - Intronic
984141331 4:176007106-176007128 AGCAAAGCCAACTTTAAAAAAGG - Intergenic
984530356 4:180908815-180908837 AGCAAAGACAAGAAGAAAAATGG - Intergenic
986560274 5:9053753-9053775 AGCAAAGTCAAGAATAAATTGGG + Intronic
986931063 5:12822183-12822205 AACAAAAACAAAGATAAATAGGG - Intergenic
988279152 5:29122908-29122930 AGCAAAGACAAACATGAAAAGGG - Intergenic
988409274 5:30865275-30865297 AACAAAAAAAACCAGAAATATGG + Intergenic
989733000 5:44669835-44669857 AGCAAAGACTCCAAGAAATATGG + Intergenic
990891359 5:60653870-60653892 AGCAAAGAAAAACATAAAGTGGG - Intronic
990912994 5:60872335-60872357 AGCAAAGGAAACAATTAATAGGG + Intergenic
991016997 5:61943075-61943097 AGCAAAGGCAGCCTTAAACAGGG + Intergenic
991368046 5:65889161-65889183 TGCAAAGACAAGCAATAATAGGG - Intergenic
992004738 5:72466278-72466300 AGCAAAAACAGCCATAGAGAAGG - Intronic
992446446 5:76838425-76838447 AGCAAAGACAACCACATCCAAGG - Intergenic
992473329 5:77078256-77078278 AACAACGACAACAATAAAAAAGG + Intronic
992523719 5:77584698-77584720 AGCAAACAAAACCATAAAATGGG + Intronic
992599431 5:78383454-78383476 AGCAAACACAACAACAAAAAAGG - Intronic
992851813 5:80817851-80817873 AGCAGAGACAACCAGACATTAGG + Intronic
993566085 5:89477489-89477511 AACAAAAAAAACTATAAATAGGG - Intergenic
993768098 5:91888498-91888520 AGTAAATAAAACCAAAAATATGG + Intergenic
994454842 5:99992527-99992549 AACATTGAGAACCATAAATAAGG + Intergenic
994590875 5:101769963-101769985 AGTAAAGATACCCAAAAATATGG - Intergenic
994998501 5:107096787-107096809 AGCTTATATAACCATAAATAAGG - Intergenic
995627407 5:114094114-114094136 AACAAGGTCACCCATAAATAAGG - Intergenic
996181517 5:120425882-120425904 AGCAAAGCCAGCAAGAAATATGG - Intergenic
996262642 5:121492457-121492479 AGAAAATGAAACCATAAATAAGG - Intergenic
996351126 5:122543009-122543031 ATCAAAAAAAACCATAAAAATGG + Intergenic
996397288 5:123026168-123026190 AACAAAGAAAGCCTTAAATATGG + Intronic
996738022 5:126775387-126775409 AGGAAATAGAACCATTAATAAGG + Intergenic
996866427 5:128128441-128128463 AGCAAACACAGACATCAATATGG - Intronic
996930758 5:128883793-128883815 AGCAAACACAAACATAAAGTGGG - Intronic
996943539 5:129039410-129039432 TGCAAAGAAAACCATACCTAAGG + Intergenic
997071210 5:130624446-130624468 AGCAAAGATAACCCTAAAGAAGG + Intergenic
998560376 5:143165994-143166016 AGCAACGATGACCATAATTACGG - Intronic
998603529 5:143609619-143609641 AGCAAACACAAACATAAAGTAGG + Intergenic
998803055 5:145890406-145890428 AGCAAAGACTTCGAGAAATATGG + Intergenic
999735985 5:154513538-154513560 AGGAAAGACAACAATAGAGATGG - Intergenic
999828521 5:155297221-155297243 AGCAAAGACAGAGATAAAGATGG - Intergenic
1000520324 5:162286953-162286975 AGCAAAGACAAACACATACAAGG - Intergenic
1001750250 5:174124214-174124236 AGCAAACAAAAACATAAATTGGG - Intronic
1001914117 5:175545334-175545356 AGCAGAGAGAAACATAAAAATGG - Intergenic
1002800518 6:517716-517738 AGCAGAGACAACCAAACATAAGG + Intronic
1002814292 6:664664-664686 AGCAAACAAAACCATAAAGTGGG + Intronic
1004783297 6:18936752-18936774 AGAACAGACAACCAGAAATTGGG - Intergenic
1004825842 6:19420146-19420168 AGAATAGAGAACCAGAAATAAGG - Intergenic
1006533234 6:34675293-34675315 AGCAAAAACAACAACAAAAAAGG + Intronic
1008675101 6:53810696-53810718 AACAAAAACATACATAAATAGGG + Intronic
1008682373 6:53886510-53886532 TTCAAAGACAATCATGAATAGGG + Intronic
1008798464 6:55336887-55336909 AACGAAGAAAACCAAAAATAAGG - Intronic
1008855214 6:56076686-56076708 ATGTAAGACAACCAAAAATATGG + Intronic
1009670701 6:66745676-66745698 AGCAAAGGAAACTATGAATAGGG - Intergenic
1009728658 6:67568922-67568944 AGCAAATATATCCATAAATAAGG + Intergenic
1010607670 6:77911226-77911248 AGCAAAGGAAACCATCAAGAGGG - Intronic
1011075697 6:83436149-83436171 AACAAAGACAAAAATAAATCAGG + Intergenic
1011152675 6:84291197-84291219 AGGAAAGATACCCAAAAATATGG - Intergenic
1011566975 6:88685602-88685624 AGCAAAGAAAACCATCAAATTGG + Intronic
1011630866 6:89322833-89322855 AGCAAACAAAAACATAAATTGGG + Intergenic
1011963727 6:93125346-93125368 AGCCAAGTCAGCCACAAATAGGG + Intergenic
1012422092 6:99076936-99076958 ATTTAAGACAAACATAAATAAGG + Intergenic
1013893864 6:115061137-115061159 AGCAAAGAAATGCATCAATAAGG + Intergenic
1014380739 6:120738007-120738029 AGAAAAGAAAACAATAAATGCGG + Intergenic
1014489484 6:122044565-122044587 AGCAAAGACAACAGTAAAATGGG + Intergenic
1014552605 6:122806385-122806407 TGCAAAGATATGCATAAATATGG - Intronic
1015987476 6:138899001-138899023 AGAAAGGGAAACCATAAATAAGG + Intronic
1015993844 6:138978025-138978047 ACCAAAGACAACAATAAGAATGG - Intronic
1016012127 6:139148221-139148243 AGCAAAGACAACCATAAATAAGG - Intronic
1016496689 6:144670900-144670922 AGCAAACACAAGCATAAAGTGGG - Intronic
1017421107 6:154274154-154274176 GGAAAAGACAACAATAAAAAAGG - Intronic
1020452906 7:8340141-8340163 AGCAATGACCACCACGAATAGGG - Intergenic
1021024007 7:15642280-15642302 AACAAAGACTTCCAGAAATATGG - Intronic
1021156145 7:17212826-17212848 AGCAAATATAAATATAAATAAGG - Intergenic
1021388102 7:20057283-20057305 AGCATATAAAACCATAAATTAGG + Intergenic
1021664174 7:22958236-22958258 AGCCAAGACTACCCTAAAAAGGG + Intronic
1021731058 7:23596184-23596206 AGCAAAGACAAGCATTCATGAGG - Intergenic
1022331081 7:29379860-29379882 AGCAAGGACAAGCATTAATAAGG + Intronic
1023097298 7:36674066-36674088 AGCAAAGATAATCATTATTAAGG - Intronic
1023152773 7:37217583-37217605 AGCAAAGAAAACCAAGAACATGG + Intronic
1023322356 7:39012195-39012217 AGCAAAGACTCCAAGAAATATGG - Intronic
1024052398 7:45634830-45634852 AGCAAAGCCAACAATAAATAAGG - Intronic
1026633107 7:72055397-72055419 AGAAAAGTTAAACATAAATATGG + Intronic
1027510702 7:79076068-79076090 ACAAAAGACAAGCAAAAATATGG + Intronic
1027515181 7:79133416-79133438 AGCAAACAAAAACATAAATTAGG - Intronic
1027750129 7:82133141-82133163 AGCAATGACAGCCTTAAACATGG + Intronic
1027793516 7:82662028-82662050 AGCAGAAGAAACCATAAATATGG + Intergenic
1027802395 7:82772073-82772095 TACAAAGACAAAGATAAATAAGG - Intronic
1028287342 7:89018861-89018883 AGAGAAGACACACATAAATAAGG - Intronic
1028402340 7:90437617-90437639 AGCAAACAAAACCATAAAGTGGG + Intronic
1028506430 7:91575923-91575945 AGCAAACACAAACATAAAGTGGG - Intergenic
1028686657 7:93597242-93597264 AGCAAAGACAATGAAAAAGATGG + Intronic
1028818703 7:95180250-95180272 AGCAAACAAAACCATAAAATGGG + Intronic
1030529156 7:110691194-110691216 AGCATAGAAAAACATAAATTGGG + Intronic
1030556016 7:111024619-111024641 AGCAACAACAACAATAAAAAAGG - Intronic
1030844710 7:114394711-114394733 AACACAGACAACCAAAATTAAGG + Intronic
1031576585 7:123422032-123422054 AACAAAAAAAACCAGAAATAAGG - Intergenic
1032161211 7:129512222-129512244 TTCAAAGACAAATATAAATATGG - Intronic
1032175590 7:129622120-129622142 ACCAAAGACAACCACTAATGGGG - Intronic
1033310164 7:140255431-140255453 AGGAAGGACATCCATAAATTAGG - Intergenic
1035343420 7:158180240-158180262 AGCATAGAAAACCATAAACTGGG - Intronic
1036814524 8:11891628-11891650 AGCTAAGACAATCCTAAACAAGG + Intergenic
1036994624 8:13641197-13641219 GGCACAGATAGCCATAAATATGG - Intergenic
1037085360 8:14842519-14842541 AGGAAAGAAAAGCAAAAATAGGG + Intronic
1039071272 8:33651271-33651293 TGTAAAGACAACCAAAAATGTGG + Intergenic
1039107511 8:34005103-34005125 TGTAAAGATAACCAAAAATATGG - Intergenic
1039268627 8:35855674-35855696 AGCAAAGACAAATAAAACTAAGG + Intergenic
1039396454 8:37229059-37229081 AGAAAAGACAAACAGAAAAATGG + Intergenic
1039823346 8:41153149-41153171 AGAAAAGAGAATAATAAATAGGG + Intergenic
1039882140 8:41631671-41631693 ATCAAAAATAACCATAAAAATGG + Intergenic
1040624760 8:49134454-49134476 TGCAAAGATATACATAAATATGG - Intergenic
1040997459 8:53416471-53416493 AGCCAAGAAAATGATAAATAAGG + Intergenic
1042089553 8:65143981-65144003 AGCAAGAACAACCATGAAAAAGG - Intergenic
1042383952 8:68151419-68151441 AACAAACAAAACCAAAAATAAGG + Intronic
1042429386 8:68687488-68687510 AGCATACAAAACCATAAATTAGG + Intronic
1042616607 8:70656447-70656469 AGCAAACAAAACCATAAAGTGGG - Intronic
1042647267 8:71001110-71001132 ATCAAGCACAACCATAAAGAAGG + Intergenic
1042969165 8:74389846-74389868 AACAAAGACTACAAGAAATATGG - Intronic
1043589395 8:81810298-81810320 AGAAATGACTACCTTAAATAGGG + Intronic
1043869436 8:85415657-85415679 AGCATAGAAAAACATAAATTGGG + Intronic
1044054345 8:87549788-87549810 AGCAAACAGAAACATAAATTGGG - Intronic
1044221348 8:89673593-89673615 AACAAAGACACCAAGAAATATGG + Intergenic
1044765465 8:95568074-95568096 AGCAAAGGAAACAATCAATATGG + Intergenic
1045760489 8:105600678-105600700 ATCCAAAACAATCATAAATAAGG - Intronic
1045840872 8:106579205-106579227 ACCAACTACAGCCATAAATAGGG - Intronic
1046283925 8:112071316-112071338 AGGATAAATAACCATAAATATGG - Intergenic
1046312895 8:112462300-112462322 ACTAAAAACAACCATAAATGGGG + Intronic
1046337352 8:112807363-112807385 AGCATACAAAACCTTAAATAGGG - Intronic
1047326506 8:123842893-123842915 AGAAGACACAACCATAAAAAAGG - Intergenic
1048324379 8:133427918-133427940 ATCAAAAACAACCATAAAAATGG + Intergenic
1048919584 8:139215745-139215767 AGCACAGACAGGTATAAATACGG - Intergenic
1050260069 9:3831932-3831954 CCCAAAGACAACTATAGATATGG - Intronic
1050400679 9:5250130-5250152 AGCAAACAAAAACATAAAGAGGG + Intergenic
1050799696 9:9594537-9594559 AGCAAACAAAAACATAAATTGGG - Intronic
1051033351 9:12711079-12711101 AGCAAAGAAACTCATTAATATGG + Intergenic
1051069933 9:13153431-13153453 AACAAAAACAAACAAAAATAGGG - Intronic
1052158267 9:25223015-25223037 AACAAAGTCAAACATAAAAAAGG + Intergenic
1052257070 9:26469783-26469805 AACAAAAACAAACATAAATCTGG - Intergenic
1052623227 9:30942073-30942095 AGAAAAGAGAACCAGAAACAGGG + Intergenic
1052763194 9:32613646-32613668 AGCAAAAACAACCACAAAGCTGG + Intergenic
1053604546 9:39643819-39643841 ATTAAAGAAACCCATAAATAAGG + Intergenic
1053862360 9:42399842-42399864 ATTAAAGAAACCCATAAATAAGG + Intergenic
1054248997 9:62698595-62698617 ATTAAAGAAACCCATAAATAAGG - Intergenic
1054563107 9:66733128-66733150 ATTAAAGAAACCCATAAATAAGG - Intergenic
1054844406 9:69777794-69777816 AGCAAAGAAAAACATAAAGTGGG - Intergenic
1055767233 9:79676624-79676646 AGAAAAGCCAACCAGAAATATGG + Intronic
1056077699 9:83058480-83058502 GGCAAAGAAAGACATAAATACGG - Intronic
1056322332 9:85447593-85447615 AGCAAAGAAAAACATAAAGTGGG - Intergenic
1056666713 9:88587242-88587264 AGGAAAGACAACCACAAGTTGGG - Intergenic
1056959434 9:91109562-91109584 AGCAAAGGAAACCATCAACAGGG + Intergenic
1057336751 9:94161654-94161676 AGCAAAGTCCTCCCTAAATAGGG + Intergenic
1057943804 9:99307236-99307258 ATCAAAGTGAACCATACATATGG - Intergenic
1058035787 9:100251216-100251238 AGCAAAGAATACAATAGATAAGG - Intronic
1058276140 9:103044140-103044162 AGCATACAAAAACATAAATAGGG + Intergenic
1059667073 9:116457379-116457401 AGCAAAGGAAACAATCAATAAGG + Intronic
1203415319 Un_KI270582v1:1276-1298 AACAAAGCCAACAAGAAATATGG - Intergenic
1185926898 X:4157267-4157289 ACCAAAGCCAAAGATAAATAGGG + Intergenic
1185963358 X:4571367-4571389 AGCATAGACAGCCAAAAATGGGG - Intergenic
1186185782 X:7018342-7018364 AGCAAACACAACTATAAATAAGG + Intergenic
1186431084 X:9504782-9504804 AACAAAGCCTACCAGAAATATGG + Intronic
1187589236 X:20698020-20698042 AGCAAACAAAAACATAAATTGGG + Intergenic
1187618387 X:21023314-21023336 AACAAAGAAAACAATACATAAGG + Intergenic
1188546848 X:31317294-31317316 AGCTAAGACAACATTAAATAGGG - Intronic
1192070234 X:67931509-67931531 AGCAAAGCAAACCCAAAATAAGG + Intergenic
1192420049 X:71021586-71021608 AACAAAAAAAACCATAAATTAGG + Intergenic
1192951230 X:76019197-76019219 AGCAAACAAAACCATAAAGTGGG + Intergenic
1193064598 X:77245602-77245624 AGCAAAGACTCCAAGAAATATGG + Intergenic
1193175999 X:78393849-78393871 AGCAAAGAAAACAATGAACACGG + Intergenic
1193313917 X:80042392-80042414 AGCAAACAAAAGCATAAAGAGGG - Intergenic
1193430791 X:81401653-81401675 AGCAAAGAAAACAATTAACAGGG - Intergenic
1193525732 X:82586098-82586120 AACAAAGACACCCATTCATATGG + Intergenic
1193616849 X:83699242-83699264 AGCAAACAGAAACATAAATTGGG - Intergenic
1193891267 X:87048985-87049007 AGCAAAGAAAACAATCAATAAGG - Intergenic
1193902312 X:87196551-87196573 TGAAAAGACAACCCAAAATATGG + Intergenic
1193938055 X:87646620-87646642 AGCAAAGAAAAACATAAAGTGGG + Intronic
1193982329 X:88198068-88198090 AGCATAGAAAAACATAAATTGGG + Intergenic
1194213931 X:91105143-91105165 AGCAAACAAAATCATAAATTAGG - Intergenic
1194353346 X:92850334-92850356 AGCAAAGACAACCTTTATCATGG + Intergenic
1194602286 X:95936979-95937001 AGCAAAGAAAAACATAAAGTGGG - Intergenic
1194634289 X:96324802-96324824 AGCAAAGTGAACCAGAAAAAAGG - Intergenic
1195818391 X:108914412-108914434 AGCAAAGAAAAACATAAAGTGGG + Intergenic
1195820728 X:108943079-108943101 AACAAAGCCAACAAGAAATATGG - Intergenic
1195999452 X:110765561-110765583 AGCAAACAAAAACATAAATGTGG - Intronic
1196587360 X:117444894-117444916 AACAAAGCCACCCAGAAATATGG + Intergenic
1196947840 X:120845538-120845560 AGCAAACAAAAACATAAAGAGGG - Intergenic
1197100626 X:122649916-122649938 AGCATAGAAAAACATAAATTGGG + Intergenic
1197126582 X:122953945-122953967 AGCATACACAAACATAAATTGGG - Intergenic
1197343951 X:125309164-125309186 AACAAAGATAACCAAAAACATGG - Intergenic
1197523666 X:127533141-127533163 AGCAAAGAAAACAATCAACAGGG + Intergenic
1198442732 X:136679753-136679775 AGCAAAGACAGCCATAGAAAGGG + Intronic
1198571427 X:137961136-137961158 AACAAAGCCAACAAGAAATATGG + Intergenic
1198592270 X:138197294-138197316 AGCAAAGAAAACAATCAACATGG - Intergenic
1198665132 X:139012573-139012595 AGCAAAGAAAAACATAAAGTGGG + Intronic
1198672735 X:139098906-139098928 AGCAAAAATAAACAAAAATAAGG + Intronic
1198796753 X:140405074-140405096 AGCAAACAAAAACATAAATTGGG - Intergenic
1199220436 X:145310395-145310417 TGCAAAGATACCCATAAATGTGG - Intergenic
1199246749 X:145613843-145613865 AGCATACACAGCAATAAATATGG - Intergenic
1200514706 Y:4130164-4130186 AGCAAATACAAACATGAATTGGG + Intergenic
1200661700 Y:5967407-5967429 AGCAAAGACAACCTTTATCATGG + Intergenic
1200765125 Y:7074553-7074575 AGCACAGACAACAATAATTTGGG + Exonic
1201938035 Y:19428478-19428500 TGCCAAGACACCCATAAACATGG + Intergenic
1201947589 Y:19528063-19528085 ATGAAAGACAACCATAAATTTGG + Intergenic
1202045519 Y:20734083-20734105 AGCACAGACAACAATAATTTGGG + Intergenic