ID: 1016014903

View in Genome Browser
Species Human (GRCh38)
Location 6:139173573-139173595
Sequence TTTAACATGGGGAAGCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016014897_1016014903 11 Left 1016014897 6:139173539-139173561 CCACTTAGGATTATGTGTTCTCC 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1016014903 6:139173573-139173595 TTTAACATGGGGAAGCACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 91
1016014899_1016014903 -10 Left 1016014899 6:139173560-139173582 CCTGATGGTAGTTTTTAACATGG 0: 1
1: 0
2: 0
3: 6
4: 156
Right 1016014903 6:139173573-139173595 TTTAACATGGGGAAGCACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016014903 Original CRISPR TTTAACATGGGGAAGCACCC TGG Intronic
900695835 1:4009863-4009885 TTCATCTTTGGGAAGCACCCAGG + Intergenic
901517134 1:9755466-9755488 TTAAACATGGGGAAGTTCTCGGG + Intronic
907732375 1:57079637-57079659 GTCAGCATGGGGAAGCAGCCAGG - Intronic
908432404 1:64071959-64071981 TGTAACATAGGGAAGCACCACGG - Intronic
908736522 1:67282665-67282687 TTAAAGATGGGGAGGCACGCTGG + Intergenic
908812072 1:67992132-67992154 TTTAACATGGAGAATCACAAAGG - Intergenic
909041647 1:70660290-70660312 TTTGACATGTTGAAGTACCCAGG + Intergenic
909438397 1:75670997-75671019 CGTAACATAGGGAAGCACCAAGG + Intergenic
911697100 1:100901737-100901759 TTTAACATGGAAAACCAGCCGGG - Intronic
914980615 1:152411381-152411403 TTTATCATGGGGAAACATCTGGG - Intronic
916071426 1:161172257-161172279 TATAAGATGGTGAAGCACCGAGG - Exonic
917507436 1:175640577-175640599 TTTACTATGTGGAAGGACCCAGG + Intronic
919905809 1:202077614-202077636 CTTCACCTGGGGCAGCACCCAGG - Intergenic
920739709 1:208569035-208569057 TATAGCATGGGGAAAGACCCTGG + Intergenic
920959829 1:210654499-210654521 ATTAACATCAGGAAACACCCTGG + Intronic
921956957 1:220994835-220994857 TTTGCAATGGGGAAGCACCCAGG - Intergenic
922257793 1:223908049-223908071 CTGAAAATGGTGAAGCACCCAGG - Intergenic
1073800279 10:107034139-107034161 TGTCACATCTGGAAGCACCCTGG + Intronic
1078420022 11:11202996-11203018 TTTCAAATGTGAAAGCACCCAGG - Intergenic
1083653630 11:64218828-64218850 TGGAACATGGGGAAGCAGTCAGG - Intronic
1086136718 11:83449120-83449142 TTTAAAATGGGAAAGTAGCCAGG + Intergenic
1086454563 11:86948300-86948322 TCTAGGATGGGGACGCACCCAGG - Exonic
1091672345 12:2461400-2461422 CTTAACATTGGGAAGCTCCAGGG + Intronic
1092867568 12:12777415-12777437 TTGAACATGGGAAAGGACCATGG - Intronic
1094026593 12:25966030-25966052 TTTATCTTGGGTAAGTACCCAGG + Intronic
1096233941 12:49913148-49913170 TGTAAGATGGGGAAGTACCTGGG + Intergenic
1101741424 12:107503058-107503080 GGTCACATGGGGAAGCACCAGGG + Intronic
1102108194 12:110343879-110343901 TATGAAATGGGGAAGAACCCGGG - Intronic
1104280634 12:127373393-127373415 TTGAAAATGGAGAAGCATCCTGG + Intergenic
1105884650 13:24631450-24631472 TCTAAAAAGGGGAAGCAGCCGGG + Intergenic
1111617751 13:90682920-90682942 TTTAAGATGGGGAGGGACACAGG + Intergenic
1112417721 13:99217561-99217583 TTGAACACAGGGAGGCACCCCGG + Intronic
1115894630 14:38072436-38072458 TTTAACTTGGAGAAGCACAAGGG - Intergenic
1117084055 14:52181059-52181081 CTTAACATGGGAAAGCAGCCAGG - Intergenic
1119150696 14:72356973-72356995 TTGAAAATGTGGAAGCAGCCAGG + Intronic
1120047918 14:79829098-79829120 TTTAACATGATGAATCACACTGG - Intronic
1125509869 15:40287106-40287128 TTGAACATAGGGCACCACCCTGG + Intronic
1127627110 15:60790467-60790489 TTTAACATGGTGTGGCACCATGG + Intronic
1129901713 15:79156645-79156667 TTTAAAATTGGGAAAGACCCAGG + Intergenic
1131912764 15:97225350-97225372 ATCAACATGGGGAAGCTCCAGGG + Intergenic
1143289441 17:5817885-5817907 TTTCAGATGGGGAAACAGCCAGG + Intronic
1153911979 18:9712399-9712421 CTTGATAGGGGGAAGCACCCTGG + Intronic
1158104681 18:53872209-53872231 TTTAACATGGTGGAGCACCTTGG + Intergenic
1158772104 18:60531632-60531654 TTTTACATGTGCATGCACCCTGG + Intergenic
1160723757 19:608660-608682 TTGGACATCGGGAAGCCCCCGGG + Intronic
1161499358 19:4605023-4605045 TGTGACAGGGGGCAGCACCCAGG + Intergenic
1164126765 19:22325533-22325555 TATAACATGGCTCAGCACCCAGG + Intergenic
1164862207 19:31570574-31570596 TATAAGCTGGGGAAGCATCCTGG + Intergenic
1168502862 19:56908167-56908189 GGGAACATGGGGAAGCACCAGGG - Intergenic
929245074 2:39692923-39692945 GTTAACATTTGGAAGCACGCAGG + Intronic
933806136 2:85999033-85999055 TTTAACATGGGGAAGGAGACAGG + Intergenic
935018407 2:99206272-99206294 TTTCACATGGTGAGCCACCCTGG + Intronic
941180115 2:162249375-162249397 TTAAAAATGGGGAAGGGCCCTGG - Intergenic
1170169921 20:13399181-13399203 TATAAGTTGGGGAAGCAACCAGG - Intronic
1172347901 20:34218616-34218638 TTTAACAGGGGGAATCAGGCTGG + Intronic
1172737301 20:37136780-37136802 TTTCACATTTGGAGGCACCCTGG - Intronic
1173616007 20:44403408-44403430 TTTACCAGGGCTAAGCACCCAGG - Intronic
1178123531 21:29493546-29493568 TTGAAAATTGGGAAGCAGCCCGG - Intronic
1178602048 21:34003006-34003028 TTTGACAAGGGGAATCACTCGGG - Intergenic
1180236428 21:46462221-46462243 ATTAACCTGTGGAAGCGCCCTGG - Intronic
1181032795 22:20156389-20156411 TCTGACATGGGGAAGCCCCAGGG - Intergenic
1181079934 22:20407109-20407131 TTTAACTAGAGGAGGCACCCTGG - Exonic
1182129633 22:27841410-27841432 TTAAACATTTGAAAGCACCCAGG + Intergenic
1183404814 22:37625194-37625216 CTTAAGATGGGGAAGGCCCCAGG + Intronic
951244874 3:20329426-20329448 TTTTACAAGTGGAAGCACACGGG - Intergenic
953735695 3:45492277-45492299 TTTAATATGCTGAAGCACCATGG + Intronic
956009503 3:64815741-64815763 CTTAAGATGGGAAATCACCCAGG - Intergenic
959400704 3:105898628-105898650 TTTAAAGTGGGGAAGGACCAAGG + Intergenic
961107293 3:124252865-124252887 TTTAAAATGGGGAGGCCTCCTGG - Intronic
961207123 3:125093428-125093450 GTTGACATGGGGAAGAACACTGG - Intronic
967759368 3:193206177-193206199 CCTCACATGGGGAAGCACCGAGG + Intergenic
967950370 3:194835777-194835799 TTTAACATCTGCAAGCACTCAGG + Intergenic
969118761 4:4891326-4891348 TTTATCATGGGGAGGCAGCGTGG + Intergenic
976165919 4:82254545-82254567 TTTAACAAGGAGAATCTCCCAGG - Intergenic
979238132 4:118424410-118424432 CTGAAAATGGTGAAGCACCCAGG + Intergenic
984682885 4:182630873-182630895 TTTAACAACTGGAAGCACACAGG - Intronic
990059169 5:51626055-51626077 TTTAATATTGGGAAGCAACATGG + Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1000127915 5:158265404-158265426 TTTCAGCTGGGGAAGGACCCTGG + Intergenic
1002377246 5:178797266-178797288 TGTAGCCTGGGCAAGCACCCTGG + Intergenic
1006686525 6:35839307-35839329 TTTAAAATGGGGTATCAGCCAGG - Intronic
1011682000 6:89792433-89792455 TTTAACATAGGGAAGGATTCTGG - Intronic
1016014903 6:139173573-139173595 TTTAACATGGGGAAGCACCCTGG + Intronic
1020039540 7:4991619-4991641 TTGAACATGGTGAAACCCCCAGG - Intronic
1021474882 7:21049740-21049762 TTTAAAATTGGGAAGTGCCCAGG + Intergenic
1025940524 7:66073537-66073559 TTTAACATGGGGTTTCAGCCGGG + Intergenic
1029546777 7:101214517-101214539 TTTAACAAAGGGAAGGTCCCTGG - Intronic
1030684671 7:112472440-112472462 TCTAACATGTGGAAGCACTCTGG - Intronic
1032506739 7:132441100-132441122 TTTACCATTGGGAGGGACCCAGG - Intronic
1034710815 7:153189942-153189964 TGCCACATGGGGAAGCACCAGGG - Intergenic
1037040567 8:14226699-14226721 TTTAACTTGGGCAATCACCTAGG + Intronic
1041444473 8:57934908-57934930 TTTAAGATGCCGAAGCAGCCAGG - Intergenic
1046441283 8:114258208-114258230 TCTAAAATGGGGAAGCAAACCGG + Intergenic
1055435316 9:76286847-76286869 TGTAAAATGGGGAAGATCCCAGG - Intronic
1058335945 9:103829063-103829085 TTAAAAATGGAGAAGCAGCCAGG - Intergenic
1188422447 X:30006795-30006817 TTTAACATTGGGAGGCACCATGG + Intergenic
1188820147 X:34765211-34765233 TTAAAAATGGAGATGCACCCAGG - Intergenic
1192784215 X:74321783-74321805 TTTAGCCTGGGGTAGCTCCCTGG + Intergenic
1198921740 X:141736503-141736525 TTTAACATAGGGAAGAATCAAGG + Intergenic
1202385911 Y:24326202-24326224 TTGAAAATGGTGAAGCACCCAGG + Intergenic
1202484875 Y:25343926-25343948 TTGAAAATGGTGAAGCACCCAGG - Intergenic