ID: 1016017903

View in Genome Browser
Species Human (GRCh38)
Location 6:139204932-139204954
Sequence TGCCACAGCCACTGTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016017903_1016017907 -9 Left 1016017903 6:139204932-139204954 CCATCCCCACAGTGGCTGTGGCA No data
Right 1016017907 6:139204946-139204968 GCTGTGGCAAGCCCTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016017903 Original CRISPR TGCCACAGCCACTGTGGGGA TGG (reversed) Intergenic
No off target data available for this crispr