ID: 1016017907

View in Genome Browser
Species Human (GRCh38)
Location 6:139204946-139204968
Sequence GCTGTGGCAAGCCCTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016017890_1016017907 30 Left 1016017890 6:139204893-139204915 CCCTATGGAACATTATCCCGATG No data
Right 1016017907 6:139204946-139204968 GCTGTGGCAAGCCCTGCCCAAGG No data
1016017902_1016017907 -8 Left 1016017902 6:139204931-139204953 CCCATCCCCACAGTGGCTGTGGC No data
Right 1016017907 6:139204946-139204968 GCTGTGGCAAGCCCTGCCCAAGG No data
1016017903_1016017907 -9 Left 1016017903 6:139204932-139204954 CCATCCCCACAGTGGCTGTGGCA No data
Right 1016017907 6:139204946-139204968 GCTGTGGCAAGCCCTGCCCAAGG No data
1016017897_1016017907 -2 Left 1016017897 6:139204925-139204947 CCACCCCCCATCCCCACAGTGGC No data
Right 1016017907 6:139204946-139204968 GCTGTGGCAAGCCCTGCCCAAGG No data
1016017894_1016017907 13 Left 1016017894 6:139204910-139204932 CCGATGGCCTGAGAACCACCCCC No data
Right 1016017907 6:139204946-139204968 GCTGTGGCAAGCCCTGCCCAAGG No data
1016017899_1016017907 -6 Left 1016017899 6:139204929-139204951 CCCCCATCCCCACAGTGGCTGTG No data
Right 1016017907 6:139204946-139204968 GCTGTGGCAAGCCCTGCCCAAGG No data
1016017895_1016017907 6 Left 1016017895 6:139204917-139204939 CCTGAGAACCACCCCCCATCCCC No data
Right 1016017907 6:139204946-139204968 GCTGTGGCAAGCCCTGCCCAAGG No data
1016017891_1016017907 29 Left 1016017891 6:139204894-139204916 CCTATGGAACATTATCCCGATGG No data
Right 1016017907 6:139204946-139204968 GCTGTGGCAAGCCCTGCCCAAGG No data
1016017898_1016017907 -5 Left 1016017898 6:139204928-139204950 CCCCCCATCCCCACAGTGGCTGT No data
Right 1016017907 6:139204946-139204968 GCTGTGGCAAGCCCTGCCCAAGG No data
1016017900_1016017907 -7 Left 1016017900 6:139204930-139204952 CCCCATCCCCACAGTGGCTGTGG No data
Right 1016017907 6:139204946-139204968 GCTGTGGCAAGCCCTGCCCAAGG No data
1016017893_1016017907 14 Left 1016017893 6:139204909-139204931 CCCGATGGCCTGAGAACCACCCC No data
Right 1016017907 6:139204946-139204968 GCTGTGGCAAGCCCTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016017907 Original CRISPR GCTGTGGCAAGCCCTGCCCA AGG Intergenic
No off target data available for this crispr