ID: 1016019405

View in Genome Browser
Species Human (GRCh38)
Location 6:139220009-139220031
Sequence TTCAACATATGAATTTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6773
Summary {0: 28, 1: 281, 2: 1011, 3: 2173, 4: 3280}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016019405_1016019414 14 Left 1016019405 6:139220009-139220031 CCCCCTCAAATTCATATGTTGAA 0: 28
1: 281
2: 1011
3: 2173
4: 3280
Right 1016019414 6:139220046-139220068 ACTGATGGTATTAGGAAGTGGGG No data
1016019405_1016019415 21 Left 1016019405 6:139220009-139220031 CCCCCTCAAATTCATATGTTGAA 0: 28
1: 281
2: 1011
3: 2173
4: 3280
Right 1016019415 6:139220053-139220075 GTATTAGGAAGTGGGGCCTTTGG 0: 23
1: 348
2: 1084
3: 2140
4: 2969
1016019405_1016019411 6 Left 1016019405 6:139220009-139220031 CCCCCTCAAATTCATATGTTGAA 0: 28
1: 281
2: 1011
3: 2173
4: 3280
Right 1016019411 6:139220038-139220060 ACTCTCAAACTGATGGTATTAGG No data
1016019405_1016019409 -1 Left 1016019405 6:139220009-139220031 CCCCCTCAAATTCATATGTTGAA 0: 28
1: 281
2: 1011
3: 2173
4: 3280
Right 1016019409 6:139220031-139220053 AATCCTTACTCTCAAACTGATGG No data
1016019405_1016019412 12 Left 1016019405 6:139220009-139220031 CCCCCTCAAATTCATATGTTGAA 0: 28
1: 281
2: 1011
3: 2173
4: 3280
Right 1016019412 6:139220044-139220066 AAACTGATGGTATTAGGAAGTGG No data
1016019405_1016019416 22 Left 1016019405 6:139220009-139220031 CCCCCTCAAATTCATATGTTGAA 0: 28
1: 281
2: 1011
3: 2173
4: 3280
Right 1016019416 6:139220054-139220076 TATTAGGAAGTGGGGCCTTTGGG 0: 29
1: 380
2: 1283
3: 2530
4: 3169
1016019405_1016019413 13 Left 1016019405 6:139220009-139220031 CCCCCTCAAATTCATATGTTGAA 0: 28
1: 281
2: 1011
3: 2173
4: 3280
Right 1016019413 6:139220045-139220067 AACTGATGGTATTAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016019405 Original CRISPR TTCAACATATGAATTTGAGG GGG (reversed) Intergenic
Too many off-targets to display for this crispr