ID: 1016019416

View in Genome Browser
Species Human (GRCh38)
Location 6:139220054-139220076
Sequence TATTAGGAAGTGGGGCCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7391
Summary {0: 29, 1: 380, 2: 1283, 3: 2530, 4: 3169}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016019407_1016019416 20 Left 1016019407 6:139220011-139220033 CCCTCAAATTCATATGTTGAAAT 0: 36
1: 266
2: 1210
3: 2687
4: 5616
Right 1016019416 6:139220054-139220076 TATTAGGAAGTGGGGCCTTTGGG 0: 29
1: 380
2: 1283
3: 2530
4: 3169
1016019406_1016019416 21 Left 1016019406 6:139220010-139220032 CCCCTCAAATTCATATGTTGAAA 0: 32
1: 299
2: 1198
3: 2758
4: 5321
Right 1016019416 6:139220054-139220076 TATTAGGAAGTGGGGCCTTTGGG 0: 29
1: 380
2: 1283
3: 2530
4: 3169
1016019410_1016019416 -3 Left 1016019410 6:139220034-139220056 CCTTACTCTCAAACTGATGGTAT No data
Right 1016019416 6:139220054-139220076 TATTAGGAAGTGGGGCCTTTGGG 0: 29
1: 380
2: 1283
3: 2530
4: 3169
1016019405_1016019416 22 Left 1016019405 6:139220009-139220031 CCCCCTCAAATTCATATGTTGAA 0: 28
1: 281
2: 1011
3: 2173
4: 3280
Right 1016019416 6:139220054-139220076 TATTAGGAAGTGGGGCCTTTGGG 0: 29
1: 380
2: 1283
3: 2530
4: 3169
1016019408_1016019416 19 Left 1016019408 6:139220012-139220034 CCTCAAATTCATATGTTGAAATC 0: 109
1: 668
2: 1885
3: 3309
4: 4389
Right 1016019416 6:139220054-139220076 TATTAGGAAGTGGGGCCTTTGGG 0: 29
1: 380
2: 1283
3: 2530
4: 3169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016019416 Original CRISPR TATTAGGAAGTGGGGCCTTT GGG Intergenic
Too many off-targets to display for this crispr