ID: 1016019437

View in Genome Browser
Species Human (GRCh38)
Location 6:139220212-139220234
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016019436_1016019437 11 Left 1016019436 6:139220178-139220200 CCATGAGAAGATGGCTGTCTATG No data
Right 1016019437 6:139220212-139220234 CTCCCACACACTGAATCTGCTGG No data
1016019434_1016019437 24 Left 1016019434 6:139220165-139220187 CCATGTGAAGTCACCATGAGAAG No data
Right 1016019437 6:139220212-139220234 CTCCCACACACTGAATCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016019437 Original CRISPR CTCCCACACACTGAATCTGC TGG Intergenic
No off target data available for this crispr