ID: 1016019440

View in Genome Browser
Species Human (GRCh38)
Location 6:139220226-139220248
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016019436_1016019440 25 Left 1016019436 6:139220178-139220200 CCATGAGAAGATGGCTGTCTATG No data
Right 1016019440 6:139220226-139220248 ATCTGCTGGTACCTTGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016019440 Original CRISPR ATCTGCTGGTACCTTGATAC TGG Intergenic