ID: 1016030508

View in Genome Browser
Species Human (GRCh38)
Location 6:139332730-139332752
Sequence TAGAGTTATGAAGAAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016030508_1016030515 13 Left 1016030508 6:139332730-139332752 CCTGCAGCTTCTTCATAACTCTA No data
Right 1016030515 6:139332766-139332788 TCTCTCTCTCTGGCTCAGACTGG No data
1016030508_1016030516 14 Left 1016030508 6:139332730-139332752 CCTGCAGCTTCTTCATAACTCTA No data
Right 1016030516 6:139332767-139332789 CTCTCTCTCTGGCTCAGACTGGG No data
1016030508_1016030512 3 Left 1016030508 6:139332730-139332752 CCTGCAGCTTCTTCATAACTCTA No data
Right 1016030512 6:139332756-139332778 GTTCCCACACTCTCTCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016030508 Original CRISPR TAGAGTTATGAAGAAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr