ID: 1016031435

View in Genome Browser
Species Human (GRCh38)
Location 6:139342841-139342863
Sequence ATCAAGGATTACCATACATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016031435_1016031439 13 Left 1016031435 6:139342841-139342863 CCTGATGTATGGTAATCCTTGAT No data
Right 1016031439 6:139342877-139342899 TTATAGATTTTTTCCTTGTTTGG No data
1016031435_1016031440 19 Left 1016031435 6:139342841-139342863 CCTGATGTATGGTAATCCTTGAT No data
Right 1016031440 6:139342883-139342905 ATTTTTTCCTTGTTTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016031435 Original CRISPR ATCAAGGATTACCATACATC AGG (reversed) Intergenic
No off target data available for this crispr