ID: 1016034850

View in Genome Browser
Species Human (GRCh38)
Location 6:139374724-139374746
Sequence GTGTTCCGGAATCCGCGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 18}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016034850_1016034862 26 Left 1016034850 6:139374724-139374746 CCAAGACGCGGATTCCGGAACAC 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1016034862 6:139374773-139374795 AGCCGCGTCCCCGCCGCCCGCGG 0: 1
1: 0
2: 1
3: 27
4: 203
1016034850_1016034853 -4 Left 1016034850 6:139374724-139374746 CCAAGACGCGGATTCCGGAACAC 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1016034853 6:139374743-139374765 ACACCGCGAACACCCTGGACCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1016034850_1016034856 3 Left 1016034850 6:139374724-139374746 CCAAGACGCGGATTCCGGAACAC 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1016034856 6:139374750-139374772 GAACACCCTGGACCGGGTCCCGG 0: 1
1: 0
2: 1
3: 2
4: 107
1016034850_1016034854 -3 Left 1016034850 6:139374724-139374746 CCAAGACGCGGATTCCGGAACAC 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1016034854 6:139374744-139374766 CACCGCGAACACCCTGGACCGGG 0: 1
1: 0
2: 0
3: 7
4: 79
1016034850_1016034852 -9 Left 1016034850 6:139374724-139374746 CCAAGACGCGGATTCCGGAACAC 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1016034852 6:139374738-139374760 CCGGAACACCGCGAACACCCTGG 0: 1
1: 0
2: 0
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016034850 Original CRISPR GTGTTCCGGAATCCGCGTCT TGG (reversed) Intergenic
905534812 1:38712944-38712966 CTGTTCCGGCATCTGCTTCTAGG - Intergenic
1077199806 11:1300718-1300740 GTGTTCAGGACTCCACGTCCTGG - Intronic
1091820615 12:3472872-3472894 GTGTTCCAGAAGCCAGGTCTTGG + Intronic
1099843977 12:88005800-88005822 GTGTTCCAGTATCCCCTTCTGGG + Intronic
1126343914 15:47673453-47673475 GTCTCCCAGAATCCACGTCTGGG + Intronic
1157948908 18:52012250-52012272 GTGTTCTGGAATACACGTTTGGG + Intergenic
1166470843 19:43078553-43078575 TTGTGCTGGAATCCGCCTCTAGG - Intronic
926117205 2:10221128-10221150 GGGCTCCGGAATTCCCGTCTGGG - Intergenic
937308522 2:120886982-120887004 GTGTTTCTGCATCTGCGTCTCGG - Intronic
937376103 2:121336783-121336805 GTGTTCTGGAATCCCTCTCTAGG - Intergenic
1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG + Exonic
952607127 3:35161802-35161824 GTGTTCCAGATTCTGCTTCTGGG - Intergenic
995686763 5:114780399-114780421 GTCTTCCAGAATCCTCTTCTAGG + Intergenic
997709387 5:135990919-135990941 GCGTTTGGGAATCCGCGGCTGGG + Intergenic
1016034850 6:139374724-139374746 GTGTTCCGGAATCCGCGTCTTGG - Intergenic
1019919467 7:4154175-4154197 GTGTTCTGGAATGGGCGTCGGGG - Intronic
1039947143 8:42140062-42140084 GTGTCCCGGCCTGCGCGTCTGGG + Intergenic
1203495183 Un_GL000224v1:144545-144567 GTGTTCCGGAATCCTATTTTAGG - Intergenic
1203507809 Un_KI270741v1:86468-86490 GTGTTCCGGAATCCTATTTTAGG - Intergenic