ID: 1016042420

View in Genome Browser
Species Human (GRCh38)
Location 6:139444830-139444852
Sequence CTCAAACAGAAAGAGATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016042420_1016042422 24 Left 1016042420 6:139444830-139444852 CCCTAGATCTCTTTCTGTTTGAG No data
Right 1016042422 6:139444877-139444899 TTATCTATCTTTAGCTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016042420 Original CRISPR CTCAAACAGAAAGAGATCTA GGG (reversed) Intergenic
No off target data available for this crispr