ID: 1016046819

View in Genome Browser
Species Human (GRCh38)
Location 6:139489485-139489507
Sequence CCTTATAAAATGATGGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016046819_1016046825 22 Left 1016046819 6:139489485-139489507 CCTTGATCCATCATTTTATAAGG No data
Right 1016046825 6:139489530-139489552 CACACTACAGCAGTTTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016046819 Original CRISPR CCTTATAAAATGATGGATCA AGG (reversed) Intergenic
No off target data available for this crispr