ID: 1016046825

View in Genome Browser
Species Human (GRCh38)
Location 6:139489530-139489552
Sequence CACACTACAGCAGTTTTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016046821_1016046825 15 Left 1016046821 6:139489492-139489514 CCATCATTTTATAAGGCCGCTTT No data
Right 1016046825 6:139489530-139489552 CACACTACAGCAGTTTTCAATGG No data
1016046819_1016046825 22 Left 1016046819 6:139489485-139489507 CCTTGATCCATCATTTTATAAGG No data
Right 1016046825 6:139489530-139489552 CACACTACAGCAGTTTTCAATGG No data
1016046822_1016046825 -1 Left 1016046822 6:139489508-139489530 CCGCTTTCTCAAGTGACACCCTC No data
Right 1016046825 6:139489530-139489552 CACACTACAGCAGTTTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016046825 Original CRISPR CACACTACAGCAGTTTTCAA TGG Intergenic
No off target data available for this crispr