ID: 1016049163

View in Genome Browser
Species Human (GRCh38)
Location 6:139512471-139512493
Sequence AATAAATAAAGGAATCCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016049163_1016049165 3 Left 1016049163 6:139512471-139512493 CCAAATGGATTCCTTTATTTATT No data
Right 1016049165 6:139512497-139512519 CTGAATCCTGCCATCATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016049163 Original CRISPR AATAAATAAAGGAATCCATT TGG (reversed) Intergenic
No off target data available for this crispr