ID: 1016051418

View in Genome Browser
Species Human (GRCh38)
Location 6:139534326-139534348
Sequence CAGAGCCATGCAAAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016051413_1016051418 -8 Left 1016051413 6:139534311-139534333 CCCAGACCACACCTTCAGAGCCA No data
Right 1016051418 6:139534326-139534348 CAGAGCCATGCAAAGCTGGAAGG No data
1016051412_1016051418 29 Left 1016051412 6:139534274-139534296 CCGGGAAAGCTGCAGTCTGCTGA No data
Right 1016051418 6:139534326-139534348 CAGAGCCATGCAAAGCTGGAAGG No data
1016051414_1016051418 -9 Left 1016051414 6:139534312-139534334 CCAGACCACACCTTCAGAGCCAT No data
Right 1016051418 6:139534326-139534348 CAGAGCCATGCAAAGCTGGAAGG No data
1016051411_1016051418 30 Left 1016051411 6:139534273-139534295 CCCGGGAAAGCTGCAGTCTGCTG No data
Right 1016051418 6:139534326-139534348 CAGAGCCATGCAAAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016051418 Original CRISPR CAGAGCCATGCAAAGCTGGA AGG Intergenic
No off target data available for this crispr