ID: 1016052905

View in Genome Browser
Species Human (GRCh38)
Location 6:139549026-139549048
Sequence GATAATGATACCCATCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016052905_1016052914 14 Left 1016052905 6:139549026-139549048 CCTGTAGGATGGGTATCATTATC No data
Right 1016052914 6:139549063-139549085 GAAGAAATAAAGGTCTAGGGGGG No data
1016052905_1016052915 19 Left 1016052905 6:139549026-139549048 CCTGTAGGATGGGTATCATTATC No data
Right 1016052915 6:139549068-139549090 AATAAAGGTCTAGGGGGGTTAGG No data
1016052905_1016052913 13 Left 1016052905 6:139549026-139549048 CCTGTAGGATGGGTATCATTATC No data
Right 1016052913 6:139549062-139549084 TGAAGAAATAAAGGTCTAGGGGG No data
1016052905_1016052910 10 Left 1016052905 6:139549026-139549048 CCTGTAGGATGGGTATCATTATC No data
Right 1016052910 6:139549059-139549081 AGATGAAGAAATAAAGGTCTAGG No data
1016052905_1016052909 4 Left 1016052905 6:139549026-139549048 CCTGTAGGATGGGTATCATTATC No data
Right 1016052909 6:139549053-139549075 TTTCACAGATGAAGAAATAAAGG No data
1016052905_1016052911 11 Left 1016052905 6:139549026-139549048 CCTGTAGGATGGGTATCATTATC No data
Right 1016052911 6:139549060-139549082 GATGAAGAAATAAAGGTCTAGGG No data
1016052905_1016052912 12 Left 1016052905 6:139549026-139549048 CCTGTAGGATGGGTATCATTATC No data
Right 1016052912 6:139549061-139549083 ATGAAGAAATAAAGGTCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016052905 Original CRISPR GATAATGATACCCATCCTAC AGG (reversed) Intergenic
No off target data available for this crispr