ID: 1016053193

View in Genome Browser
Species Human (GRCh38)
Location 6:139551530-139551552
Sequence ACCACACTAGGTTTGTAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016053193_1016053197 25 Left 1016053193 6:139551530-139551552 CCTGTCTACAAACCTAGTGTGGT No data
Right 1016053197 6:139551578-139551600 GAGATCTGAGGATGTGCCTCTGG No data
1016053193_1016053196 13 Left 1016053193 6:139551530-139551552 CCTGTCTACAAACCTAGTGTGGT No data
Right 1016053196 6:139551566-139551588 GCTGTCTTCTTGGAGATCTGAGG No data
1016053193_1016053195 3 Left 1016053193 6:139551530-139551552 CCTGTCTACAAACCTAGTGTGGT No data
Right 1016053195 6:139551556-139551578 CAGTCTGAGTGCTGTCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016053193 Original CRISPR ACCACACTAGGTTTGTAGAC AGG (reversed) Intergenic
No off target data available for this crispr