ID: 1016054458

View in Genome Browser
Species Human (GRCh38)
Location 6:139565229-139565251
Sequence GTTTGTTTAGAGGAAAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016054458_1016054463 17 Left 1016054458 6:139565229-139565251 CCCTCACTTTCCTCTAAACAAAC No data
Right 1016054463 6:139565269-139565291 AGCTGTGTTGCCTATAGCTGGGG No data
1016054458_1016054465 22 Left 1016054458 6:139565229-139565251 CCCTCACTTTCCTCTAAACAAAC No data
Right 1016054465 6:139565274-139565296 TGTTGCCTATAGCTGGGGGAAGG No data
1016054458_1016054464 18 Left 1016054458 6:139565229-139565251 CCCTCACTTTCCTCTAAACAAAC No data
Right 1016054464 6:139565270-139565292 GCTGTGTTGCCTATAGCTGGGGG No data
1016054458_1016054462 16 Left 1016054458 6:139565229-139565251 CCCTCACTTTCCTCTAAACAAAC No data
Right 1016054462 6:139565268-139565290 TAGCTGTGTTGCCTATAGCTGGG No data
1016054458_1016054461 15 Left 1016054458 6:139565229-139565251 CCCTCACTTTCCTCTAAACAAAC No data
Right 1016054461 6:139565267-139565289 GTAGCTGTGTTGCCTATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016054458 Original CRISPR GTTTGTTTAGAGGAAAGTGA GGG (reversed) Intergenic
No off target data available for this crispr